Advertisement

HMGN2 represses gene transcription via interaction with transcription factors Lef-1 and Pitx2 during amelogenesis

Open AccessPublished:July 20, 2022DOI:https://doi.org/10.1016/j.jbc.2022.102295
      The chromatin-associated high mobility group protein N2 (HMGN2) cofactor regulates transcription factor activity through both chromatin and protein interactions. Hmgn2 expression is known to be developmentally regulated, but the post-transcriptional mechanisms that regulate Hmgn2 expression and its precise roles in tooth development remain unclear. Here, we demonstrate that HMGN2 inhibits the activity of multiple transcription factors as a general mechanism to regulate early development. Bimolecular fluorescence complementation, pull-down, and coimmunoprecipitation assays show that HMGN2 interacts with the transcription factor Lef-1 through its HMG-box domain as well as with other early development transcription factors, Dlx2, FoxJ1, and Pitx2. Furthermore, EMSAs demonstrate that HMGN2 binding to Lef-1 inhibits its DNA-binding activity. We found that Pitx2 and Hmgn2 associate with H4K5ac and H3K4me2 chromatin marks in the proximal Dlx2 promoter, demonstrating Hmgn2 association with open chromatin. In addition, we demonstrate that microRNAs (miRs) mir-23a and miR-23b directly target Hmgn2, promoting transcriptional activation at several gene promoters, including the amelogenin promoter. In vivo, we found that decreased Hmgn2 expression correlates with increased miR-23 expression in craniofacial tissues as the murine embryo develops. Finally, we show that ablation of Hmgn2 in mice results in increased amelogenin expression because of increased Pitx2, Dlx2, Lef-1, and FoxJ1 transcriptional activity. Taken together, our results demonstrate both post-transcriptional regulation of Hmgn2 by miR-23a/b and post-translational regulation of gene expression by Hmgn2–transcription factor interactions. We conclude that HMGN2 regulates tooth development through its interaction with multiple transcription factors.

      Keywords

      Abbreviations:

      Ab (antibody), β-cat (β-catenin), BiFC (bimolecular fluorescence complementation), ChIP (chromatin immunoprecipitation), CHO (Chinese hamster ovary), CMV (cytomegalovirus), co-IP (coimmunoprecipitation), DSPP (dentin sialo phosphoprotein), EYFP (enhanced YFP), GST (glutathione-S-transferase), HEK-293 (human embryonic kidney 293 cell line), HMGN2 (high mobility group protein N2), IgG (immunoglobulin G), IP (immunoprecipitation), LaCL (labial cervical loop), MEF (mouse embryo fibroblast), miR (microRNA), PBST (PBS with Tween 20), PFS (paraformaldehyde), qPCR (quantitative PCR), TAC (transient amplifying cell), TG (transgenic), TSS (transcription start site)
      High mobility group N (HMGN) is a family of nonhistone chromatin architectural proteins that bind to the nucleosome core structure independent of DNA sequence to affect chromatin structure and function and regulate transcription (
      • Shirakawa H.
      • Herrera J.E.
      • Bustin M.
      • Postnikov Y.
      Targeting of high mobility group-14-17 proteins in chromatin is independent of DNA sequence.
      ,
      • Murphy K.J.
      • Cutter A.R.
      • Fang H.
      • Postnikov Y.V.
      • Bustin M.
      • Hayes J.J.
      HMGN1 and 2 remodel core and linker histone tail domains within chromatin.
      ,
      • Garza-Manero S.
      • Sindi A.A.A.
      • Mohan G.
      • Rehbini O.
      • Jeantet V.H.M.
      • Bailo M.
      • et al.
      Maintenance of active chromatin states by HMGN2 is required for stem cell identity in a pluripotent stem cell model.
      ,
      • Martínez de Paz A.
      • Ausió J.
      HMGNs: the enhancer charmers.
      ,
      • He B.
      • Deng T.
      • Zhu I.
      • Furusawa T.
      • Zhang S.
      • Tang W.
      • et al.
      Binding of HMGN proteins to cell specific enhancers stabilizes cell identity.
      ,
      • Bustin M.
      Chromatin unfolding and activation by HMGN∗ chromosomal proteins.
      ). These nucleosome-binding proteins can colocalize with epigenetic marks of active chromatin and cell type–specific enhancers/promoters and regulate transcription levels (
      • Martínez de Paz A.
      • Ausió J.
      HMGNs: the enhancer charmers.
      ,
      • He B.
      • Deng T.
      • Zhu I.
      • Furusawa T.
      • Zhang S.
      • Tang W.
      • et al.
      Binding of HMGN proteins to cell specific enhancers stabilizes cell identity.
      ,
      • Bustin M.
      Chromatin unfolding and activation by HMGN∗ chromosomal proteins.
      ,
      • Trieschmann L.
      • Postnikov Y.V.
      • Rickers A.
      • Bustin M.
      Modular structure of chromosomal proteins HMG-14 and HMG-17; definition of a transcriptional activation domain distinct from the nucleosomal binding domain.
      ). Hmgn2 may be required for stem cell maintenance through specific activation of stem cell factors and induction of active epigenetic marks (
      • Garza-Manero S.
      • Sindi A.A.A.
      • Mohan G.
      • Rehbini O.
      • Jeantet V.H.M.
      • Bailo M.
      • et al.
      Maintenance of active chromatin states by HMGN2 is required for stem cell identity in a pluripotent stem cell model.
      ,
      • He B.
      • Deng T.
      • Zhu I.
      • Furusawa T.
      • Zhang S.
      • Tang W.
      • et al.
      Binding of HMGN proteins to cell specific enhancers stabilizes cell identity.
      ,
      • Catez F.
      • Yang H.
      • Tracey K.J.
      • Reeves R.
      • Misteli T.
      • Bustin M.
      Network of dynamic interactions between histone H1 and high-mobility-group proteins in chromatin.
      ,
      • Phair R.D.
      • Mistell T.
      High mobility of proteins in the mammalian cell nucleus.
      ). We have previously shown that Hmgn2 forms an inactive transcriptional complex with transcription factor Pitx2, which bound to chromatin, and poised to activate transcription (
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ). This inactive complex is then activated through Wnt signaling and the interaction with β-catenin (β-cat) (
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ). A similar mechanism was proposed recently stating that HMGN proteins open chromatin structure at enhancer regions maintaining them in a poised open chromatin state, ready for rapid stimuli-dependent gene expression (
      • Martínez de Paz A.
      • Ausió J.
      HMGNs: the enhancer charmers.
      ). More recently, a study demonstrated that HMGN2 protein could localize to cell-specific enhancers to modulate the chromatin epigenetic landscape (
      • He B.
      • Deng T.
      • Zhu I.
      • Furusawa T.
      • Zhang S.
      • Tang W.
      • et al.
      Binding of HMGN proteins to cell specific enhancers stabilizes cell identity.
      ). These data all point to HMGN2 as a critical regulator of transcriptional activation of gene expression. Hmgn2 expression occurs during early mouse embryogenesis and affects the timing of early embryonic development in the mouse (
      • Mohamed O.A.
      • Bustin M.
      • Clarke H.J.
      High-mobility group proteins 14 and 17 maintain the timing of early embryonic development in the mouse.
      ). The expression of Hmgn2 is reduced in adult tissues (
      • Lehtonen S.
      • Olkkonen V.M.
      • Stapleton M.
      • Zerial M.
      • Lehtonen E.
      HMG-17, a chromosomal non-histone protein, shows developmental regulation during organogenesis.
      ), and in multiple tissues, it correlates with gene expression regulating developmental processes.
      Lymphoid enhancer–binding factor 1 gene (Lef-1) plays a critical role in organ, craniofacial, and tooth development. The Lef-1 protein contains an HMG-box domain and has been shown to act as a transcription factor (
      • Travis A.
      • Amsterdam A.
      • Belanger C.
      • Grosschedl R.
      LEF-1, a gene encoding a lymphoid-specific protein with an HMG domain, regulates T-cell receptor a enhancer function.
      ). The role of Hmgn2 in development remains unclear and, in this report, we analyzed Hmgn2-null mice for developmental defects and its interaction with Lef-1.
      Pitx2 is the earliest transcription factor observed in tooth development, which marks dental epithelial but not mesenchymal tissues and directly activates several genes regulating dental epithelial stem cells, embryonic tooth development, and enamel formation (
      • Amendt B.A.
      • Sutherland L.B.
      • Semina E.
      • Russo A.F.
      The molecular basis of rieger syndrome: analysis of Pitx2 homeodomain protein activities.
      ,
      • Semina E.V.
      • Reiter R.
      • Leysens N.J.
      • Alward L.M.
      • Small K.W.
      • Datson N.A.
      • et al.
      Cloning and characterization of a novel bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger syndrome.
      ,
      • Gage P.J.
      • Suh H.
      • Camper S.A.
      The bicoid-related Pitx gene family in development.
      ,
      • Lin C.R.
      • Kioussi C.
      • O'Connell S.
      • Briata P.
      • Szeto D.
      • Liu F.
      • et al.
      Pitx2 regulates lung asymmetry, cardiac positioning and pituitary and tooth morphogenesis.
      ,
      • Lu M.
      • Pressman C.
      • Dyer R.
      • Johnson R.L.
      • Martin J.F.
      Function of Rieger syndrome gene in left-right asymmetry and craniofacial development.
      ,
      • Wang J.
      • Saadi I.
      • Wang J.
      • Engel J.J.
      • Kaburas A.
      • Russo A.F.
      • et al.
      PIAS1 and PIASy differentially regulate PITX2 transcriptional activities.
      ). Pitx2 has long been considered as a master regulator of the transcriptional hierarchy in early tooth development, including stem cells (
      • Pispa J.
      • Thesleff I.
      Mechanisms of ectodermal organogenesis.
      ,
      • Tucker A.
      • Sharpe P.
      The cutting-edge of mammalian development; how the embryo makes teeth.
      ). Pitx2 regulates Sox2 and Lef-1 expression in the dental epithelium, and we previously demonstrated that HMGN2 represses Pitx2 and Sox2 transcriptional activation (
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ,
      • Vadlamudi U.
      • Espinoza H.M.
      • Ganga M.
      • Martin D.M.
      • Liu X.
      • Engelhardt J.F.
      • et al.
      PITX2, β-catenin, and LEF-1 interact to synergistically regulate the LEF-1 promoter.
      ,
      • Amen M.
      • Liu X.
      • Vadlamudi U.
      • Elizondo G.
      • Diamond E.
      • Engelhardt J.F.
      • et al.
      PITX2 and β-catenin interactions regulate lef-1 isoform expression.
      ,
      • Sun Z.
      • Yu W.
      • Sanz Navarro M.
      • Sweat M.
      • Eliason S.
      • Sharp T.
      • et al.
      Sox2 and Lef-1 interact with Pitx2 to regulate incisor development and stem cell renewal.
      ,
      • Sweat Y.Y.
      • Sweat M.
      • Yu W.
      • Sanz-Navarro M.
      • Zhang L.
      • Sun Z.
      • et al.
      Sox2 controls periderm and rugae development to inhibit oral adhesions.
      ). The ablation of Lef-1 in the dental epithelium leads to severe tooth developmental defects, causing an arrest during the transition from bud to cap stage (
      • van Genderen C.
      • Okamura R.M.
      • Farinas I.
      • Quo R.-G.
      • Parslow T.G.
      • Bruhn L.
      • et al.
      Development of several organs that require inductive epithelial-mesenchymal interactions is impared in LEF-1-deficient mice.
      ,
      • Sasaki T.
      • Ito Y.
      • Xu X.
      • Han J.
      • Bringas J.,P.
      • Maeda T.
      • et al.
      LEF1 is a critical epithelial survival factor during tooth morphogenesis.
      ). We have shown that conditional overexpression of Lef-1 in the dental epithelium results in a new stem cell compartment with increased dental epithelial cell proliferation affecting amelogenin expression and enamel formation (
      • Sun Z.
      • Yu W.
      • Sanz Navarro M.
      • Sweat M.
      • Eliason S.
      • Sharp T.
      • et al.
      Sox2 and Lef-1 interact with Pitx2 to regulate incisor development and stem cell renewal.
      ).
      MicroRNA (miR)-mediated gene silencing plays important roles in many biological processes, such as cell proliferation, differentiation, and death (
      • Zhao Y.
      • Ransom J.F.
      • Li A.
      • Vedantham V.
      • von Drehle M.
      • Muth A.N.
      • et al.
      Dysregulation of cardiogenesis, cardiac conduction, and cell cycle in mice lacking miRNA-1-2.
      ,
      • Ucar A.
      • Vafaizadeh V.
      • Jarry H.
      • Fiedler J.
      • Klemmt P.A.B.
      • Thum T.
      • et al.
      miR-212 and miR-132 are required for epithelial stromal interactions necessary for mouse mammary gland development.
      ). miRs are ∼22 nt endogenous RNAs that bind to sequences within 3′UTR of protein-coding genes to post-transcriptionally regulate gene function (
      • Grimson A.
      • Farh K.K.
      • Johnston W.K.
      • Garrett-Engele P.
      • Lim L.P.
      • Bartel D.P.
      MicroRNA targeting specificity in mammals: determinants beyond seed pairing.
      ). miRs have been reported to play critical roles in tooth development. For example, the inactivation of Dicer1 in dental epithelium results in severe phenotypes, such as loss of enamel and multiple teeth (
      • Cao H.
      • Wang J.
      • Li X.
      • Florez S.
      • Huang Z.
      • Venugopalan S.R.
      • et al.
      MicroRNAs play a critical role in tooth development.
      ). miR-23a and miR-23b are encoded by the miR-23a-27a-24 (mouse chromosome 8) and miR-23b-27b-24 clusters (mouse chromosome 13), respectively, and their expression has been reported to play an important role in endocrine homeostasis (
      • Shen Y.
      • Li Y.
      • Ye F.
      • Wang F.
      • Wan X.
      • Lu W.
      • et al.
      Identification of miR-23a as a novel microRNA normalizer for relative quantification in human uterine cervical tissues.
      ), cell death (
      • Chen Q.
      • Xu J.
      • Li L.
      • Li H.
      • Mao S.
      • Zhang F.
      • et al.
      MicroRNA-23a/b and microRNA-27a/b suppress Apaf-1 protein and alleviate hypoxia-induced neuronal apoptosis.
      ), glutamine metabolism (
      • Gao P.
      • Tchernyshyov I.
      • Chang T.C.
      • Lee Y.S.
      • Kita K.
      • Ochi T.
      • et al.
      c-Myc suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism.
      ), and cancer development (
      • Viswanathan V.
      • Damle S.
      • Zhang T.
      • Opdenaker L.
      • Modarai S.
      • Accerbi M.
      • et al.
      An miRNA expression signature for the human colonic stem cell niche distinguishes malignant from normal epithelia.
      ). A large-scale screen for miR expression profiles in the tooth germs of miniature pigs reveals that both miR-23a and b are highly expressed during tooth development (
      • Li A.
      • Song T.
      • Wang F.
      • Liu D.
      • Fan Z.
      • Zhang C.
      • et al.
      MicroRNAome and expression profile of developing tooth germ in miniature pigs.
      ). We showed that miR-23a+b are highly expressed in the mouse dental epithelial cells using microarray analysis by comparing the miR expression profiles between differentiated and undifferentiated dental epithelial tissues (
      • Cao H.
      • Wang J.
      • Li X.
      • Florez S.
      • Huang Z.
      • Venugopalan S.R.
      • et al.
      MicroRNAs play a critical role in tooth development.
      ).
      In this report, we describe new molecular and developmental mechanisms for the HMGN2 protein. HMGN2 is a chromatin-associated factor able to inhibit transcription factor DNA binding and transcriptional activation. Furthermore, HMGN2 acts as a general regulator of multiple transcription factors and is directly targeted by miR-23a+b. Interestingly, as development progresses the expression of Hmgn2 in the mouse gradually decreases in a manner that was inversely correlated with miR-23a+b during tooth development and amelogenin expression, the gene required for enamel formation. Finally, deletion of Hmgn2 in mice resulted in increased amelogenin expression affecting tooth development. Our research defines HMGN2 as a general regulator of transcription factor activity through protein interactions associated with active chromatin marks. This report describes both post-transcriptional and post-translational mechanisms to regulate multiple genes by HMGN2.

      Results

      HMGN2 interacts with Lef-1 in the nucleus and represses Lef-1 transcriptional activity

      We have used a cell model to demonstrate a direct interaction between Lef-1 and HMGN2 and their cellular localization by performing the bimolecular fluorescence complementation (BiFC) assay. Lef-1 was ligated to the N terminus of an EYFP-N (EYFP [enhanced YFP]) coding sequence, and HMGN2 was cloned to the N-terminal region of an EYFP-C sequence (Fig. 1A). Direct physical association between Lef-1-YN and HMGN2-YC resulted in fluorescence under EYFP excitation wavelength because of interactions between N and C fragments of the EYFP protein (Fig. 1B) (
      • Hu C.-D.
      • Chinenov Y.
      • Kerppola T.K.
      Visualization of interactions among bZIP and rel family proteins in living cells using bimolecular fluorescence complementation.
      • Zhang Z.
      • Gutierrez D.
      • Li X.
      • Wang J.
      • Andrade K.
      • Amendt B.A.
      Homeodomain transcription factor Lhx6: a transcriptional repressor that interacts with PITX2 to regulate odontogenesis.
      ). As shown in Figure 1C, Lef-1-YN and HMGN2-YC interact to produce fluorescence that is confined to the nucleus. As controls, transfecting either Lef-1-YN with the FLAG-EYFP-C fragment (FLAG-YC) or HMGN2-YC with FLAG-EYFP-N fragment (FLAG-YN) did not emit fluorescence (Fig. 1C). These results indicate that Lef-1 and HMGN2 interact in the nucleus of living cells.
      Figure thumbnail gr1
      Figure 1Lef-1 interacts with HMGN2 in the nucleus, and HMGN2 represses Lef-1 transcriptional activity. A and B, schematic of the constructs used in bimolecular fluorescence complementation (BiFC) assay. Lef-1 (murine clone) was cloned into the pFLAG-CMV-2 plasmid (Sigma) containing an N-terminal fragment of EYFP, and HMGN2 (human clone) FC was ligated to a C-terminal fragment of EYFP in the pFLAG-CMV-2 plasmid. YN or YC fragments only were ligated into the vector and used as negative controls. The interaction between the proteins facilitates the association of YN and YC fragments to produce fluorescence under EYFP excitation wavelength. C, the constructs were transfected into HEK-293 cells. After 24 h, Nikon 80i fluorescence microscope was used to detect the fluorescence. The scale bar represents 5 μm. D, HMGN2 represses Lef-1 transcriptional activation. A schematic of the 3276 bp Dlx2 promoter is shown with Lef-1–binding sites. LS-8 cells were transfected with Dlx2 promoter luciferase reporter gene (5 μg) and Lef-1 and/or β-catenin with/without HMGN2 expression plasmids (2.5 μg) and a β-galactosidase expression construct (0.5 μg). After 48 h, luciferase and β-galactosidase activities were measured. The luciferase activities were shown as mean fold activation compared with the normalized luciferase activity in empty vector (pcDNA 3.1) with Dlx2 promoter reporter. N = 4, ∗p < 0.05. E, coimunoprecipitation of endogenous Lef-1 and Hmgn2. LS-8 epithelial cells were harvested,and Lef-1 Ab was used to pull down Hmgn2. Hmgn2 protein is shown by Western blot. CMV, cytomegalovirus; EYFP, enhanced YFP; HEK-293, human embryonic kidney 293 cell line; HMGN2, high mobility group protein N2.
      We have demonstrated that HMGN2 interacts with Pitx2 and Sox2 to form an inactive complex to inhibit Pitx2 and Sox2 DNA-binding activity (
      • Amen M.
      • Liu X.
      • Vadlamudi U.
      • Elizondo G.
      • Diamond E.
      • Engelhardt J.F.
      • et al.
      PITX2 and β-catenin interactions regulate lef-1 isoform expression.
      ,
      • Sun Z.
      • Yu W.
      • Sanz Navarro M.
      • Sweat M.
      • Eliason S.
      • Sharp T.
      • et al.
      Sox2 and Lef-1 interact with Pitx2 to regulate incisor development and stem cell renewal.
      ,
      • Sweat Y.Y.
      • Sweat M.
      • Yu W.
      • Sanz-Navarro M.
      • Zhang L.
      • Sun Z.
      • et al.
      Sox2 controls periderm and rugae development to inhibit oral adhesions.
      ,
      • Li X.
      • Venugopalan S.
      • Cao H.
      • Pinho F.
      • Paine M.L.
      • Snead M.L.
      • et al.
      A model for the molecular underpinnings of tooth defects in axenfeld-rieger syndrome.
      ). Dlx2 is required for craniofacial and tooth development, and we have shown that Pitx2 and Lef-1 regulate the Dlx2 promoter (
      • Amen M.
      • Liu X.
      • Vadlamudi U.
      • Elizondo G.
      • Diamond E.
      • Engelhardt J.F.
      • et al.
      PITX2 and β-catenin interactions regulate lef-1 isoform expression.
      ,
      • Cox C.J.
      • Espinoza H.M.
      • McWilliams B.
      • Chappell K.
      • Morton L.
      • Hjalt T.A.
      • et al.
      Differential regulation of gene expression by PITX2 isoforms.
      ,
      • Diamond E.
      • Amen M.
      • Hu Q.
      • Espinoza H.M.
      • Amendt B.A.
      Functional interactions between Dlx2 and lymphoid enhancer factor regulate Msx2.
      ). To determine if HMGN2 regulates Lef-1 activation of the Dlx2 promoter, we cotransfected the Dlx2 promoter luciferase reporter, Lef-1 and ß-catenin with/without HMGN2 in LS-8 oral epithelial cells. The luciferase results show that Lef-1 activated the Dlx2 promoter, but this activation was significantly reduced while overexpressing HMGN2 (Fig. 1D). Furthermore, cotransfection with β-cat rescued Lef-1 transcriptional inhibition by the HMGN2 protein. Therefore, HMGN2 inhibits Lef-1 transactivation of the Dlx2 promoter, and the Lef-1 interaction with β-cat overcomes this inhibition. Coimmunoprecipitation (co-IP) assays also demonstrate a direct interaction of endogenous Hmgn2 with endogenous Lef-1 in LS-8 oral epithelial cells (Fig. 1E).

      HMGN2 interacts with the Lef-1 HMG-box domain

      To map the Lef-1 domain that interacts with HMGN2, glutathione-S-transferase (GST) pull-down experiments were performed using purified bacteria-expressed proteins. A schematic diagram of the immobilized GST-Lef-1 full-length and truncated proteins is shown (Fig. 2A). Full-length HMGN2 protein was used in the pull-down experiments and immobilized GST-Lef-1, GST-Lef-1 ΔN113, GST-Lef-1ΔN295, and GST-Lef-1 ΔN113-ΔC34 all bound HMGN2 protein (Fig. 2B). However, GST-Lef-1 ΔN363 and GST-Lef-1 ΔN113-ΔC102 did not bind HMGN2 protein (Fig. 2B). From these experiments, we identified that HMGN2 interacts with the Lef-1 HMG-box domain (Fig. 2A).
      Figure thumbnail gr2
      Figure 2HMGN2 interacts with the HMG-box domain in the Lef-1 protein. A, schematic of the Lef-1 protein and truncated proteins. The location of the HMGN2-binding domain in the Lef-1 protein is shown. B, GST-Lef-1 protein pull-down assay with bacterial-expressed and purified HMGN2 protein (100 ng). To demonstrate HMGN2 binding to Lef-1, Lef-1 protein was incubated with purified HMGN2 protein. HMGN2 binds to the Lef-1 HMG domain. C, coimmunoprecipitation (IP) experiments demonstrate a Lef-1–HMGN2–β-catenin (β-cat) complex in CHO cells. Lef-1, HMGN2, and/or β-cat (2.5 μg) were transfected into CHO cells. Cell lysates were incubated with β-cat antibody (Ab), and the IP complex was isolated and resolved on a 10% SDS-polyacrylamide gel and probed for HMGN2 using the HMGN2 Ab. The β-cat antibody immunoprecipitated the Lef-1–HMGN2–β-cat complex, denoted by the asterisk. HMGN2 was detected only in the β-cat–Lef-1–HMGN2 precipitated complex. HMGN2 does not bind to β-cat. As controls transfected β-cat input, cotransfected β-cat and HMGN2, cotransfected β-cat and Lef-1, and all three cotransfected protein inputs were probed for HMGN2 protein. The proteins were visualized using ECL reagents. CHO, Chinese hamster ovary; GST, glutathione-S-transferase; HMGN2, high mobility group protein N2.
      Because it is well known that β-cat and Lef-1 interact, we asked if Lef-1 interacts with HMGN2 in the presence of β-cat. An immunoprecipitation (IP) assay was performed to detect HMGN2 binding to endogenous β-cat and transfected Lef-1 and HMGN2 in Chinese hamster ovary (CHO) cells (Fig. 2C). β-cat was immunoprecipitated from CHO cells transfected with plasmids for HMGN2 and Lef-1, and immunoprecipitates were then probed for HMGN2 protein. HMGN2 bound only to the β-cat–Lef-1 complex and not to β-cat alone (Fig. 2C).

      HMGN2 inhibits Lef-1 DNA-binding activity

      HMGN2 inhibits Lef-1 transcriptional activity through direct interactions in the cell nucleus. However, the mechanism for this inhibition is not known. We asked if HMGN2 inhibited Lef-1 DNA-binding activity because of its interaction with the Lef-1 HMG-box domain. Interestingly, titration of purified HMGN2 after Lef-1 binding to a labeled Lef-1-binding sequence (Lef-1 probe) in an EMSA showed that HMGN2 acts to inhibit Lef-1 binding to its DNA-binding element (Fig. 3). HMGN2 binds nonspecifically to the DNA probe as shown previously (
      • Amen M.
      • Liu X.
      • Vadlamudi U.
      • Elizondo G.
      • Diamond E.
      • Engelhardt J.F.
      • et al.
      PITX2 and β-catenin interactions regulate lef-1 isoform expression.
      ). Thus, HMGN2 can bind to Lef-1 bound to DNA and remove Lef-1 from the DNA. This represents a unique function of HMGN2 to regulate transcription factor activity.
      Figure thumbnail gr3
      Figure 3HMGN2 removes Lef-1 bound to DNA. HMGN2 protein (4, 10, 15, 20, and 40 ng) was incubated with the Dlx2 promoter sequence containing a Lef-1 binding element as the radioactive probe in an EMSA. HMGN2 bound nonspecifically to the DNA probe as previously reported. Lef-1 protein (80 ng) bound to the DNA. HMGN2 titration (4, 10, 15, 20, and 40 ng) after Lef-1 bound to the probe revealed that HMGN2 inhibited Lef-1 binding in a dose-responsive manner. The EMSA experiments were analyzed in 8% native polyacrylamide gels. The free and bound forms of DNA were quantitated using the Molecular Dynamics STORM PhosphoImager. The free probe and bound DNA are indicated. HMGN2, high mobility group protein N2.

      Lef-1 and Pitx2 regulate the Hmgn2 promoter, and HMGN2 feeds back to inhibit Lef-1 and Pitx2 DNA binding, which is derepressed by β-cat

      Because Lef-1 and Pitx2 are early developmental transcription factors and HMGN2 is expressed in early development, we asked if they regulated HMGN2 expression. The Hmgn2 promoter has several Lef-1- and Pitx2-binding sites (Fig. S1A). We cloned the Hmgn2 promoter (11 kb) into a luciferase construct and transfected it with plasmid DNA encoding Lef-1, HMGN2, β-cat, and Pitx2 combinations in CHO cells. Our results showed that Lef-1 activates the Hmgn2 promoter at approximately sixfold, and addition of HMGN2 represses Lef-1 activation as predicted (Fig. S1B). β-cat derepresses the HMGN2 inhibition of Lef-1 transcriptional activation of the Hmgn2 promoter. Pitx2 activation of the Hmgn2 promoter is also repressed by HMGN2 and derepressed by addition of β-cat (Fig. S1B). We have shown previously that β-cat can derepress Pitx2 inhibition by HMGN2 by forming a complex that allows for Pitx2 binding to DNA (
      • Amen M.
      • Liu X.
      • Vadlamudi U.
      • Elizondo G.
      • Diamond E.
      • Engelhardt J.F.
      • et al.
      PITX2 and β-catenin interactions regulate lef-1 isoform expression.
      ). We speculate that a similar mechanism is working for Lef-1 transcriptional activation. We assayed for endogenous Hmgn2 transcripts isolated from E14.5 Pitx2−/− null embryo mandibles and found that Hmgn2 transcripts were significantly decreased because of the lack of Pitx2 expression (Fig. S1C). Thus, both Lef-1 and Pitx2 appear to regulate Hmgn2 causing a new feedback mechanism where increased Hmgn2 protein would inhibit Pitx2 and Lef-1 activation of Hmgn2 expression.

      Dlx2 and FoxJ1 transcription factors are inhibited by HMGN2

      Dlx2 and FoxJ1 are transcription factors involved in the developmental regulation of the craniofacial region and teeth (
      • Green P.D.
      • Hjalt T.A.
      • Kirk D.E.
      • Sutherland L.B.
      • Thomas B.L.
      • Sharpe P.T.
      • et al.
      Antagonistic regulation of Dlx2 expression by PITX2 and Msx2: implications for tooth development.
      ,
      • Espinoza H.M.
      • Cox C.J.
      • Semina E.V.
      • Amendt B.A.
      A molecular basis for differential developmental anomalies in Axenfeld-Rieger syndrome.
      ,
      • Venugopalan S.R.
      • Amen M.A.
      • Wang J.
      • Wong L.
      • Cavender A.C.
      • D'Souza R.N.
      • et al.
      Novel expression and transcriptional regulation of FoxJ1 during oro-facial morphogenesis.
      ). We asked if HMGN2 also regulated the transcriptional activity of these different Dlx and Fox family transcription factors. Both Dlx2 and FoxJ1 can activate their own promoter and are expressed in similar tissues with Hmgn2. The Dlx2 promoter-luciferase construct was transfected into three cell lines (CHO, LS-8, and human embryonic kidney 293 [HEK-293] cell lines) with empty vector, HMGN2, Dlx2 or HMGN2 and Dlx2 together, and luciferase activity was measured as a readout of promoter activation (Fig. 4). Both empty vector control and HMGN2 expression did not activate the Dlx2 promoter (Fig. 4A). However, Dlx2 activated the Dlx2 promoter at approximately 10-fold in all cells, and HMGN2 repressed Dlx2 activation of the promoter in all cell lines (Fig. 4A). The FoxJ1 promoter-luciferase construct was transfected in all cell lines as in panel A, with empty vector as a control, HMGN2, FoxJ1, and both HMGN2 and FoxJ1 (Fig. 4B). Identical to the Dlx2 promoter, FoxJ1 activated its own promoter, and HMGN2 alone had no effect on FoxJ1 promoter activity. However, HMGN2 repressed FoxJ1 activation of the FoxJ1 promoter in all cell lines (Fig. 4B). FoxJ1 and Dlx2 directly interact with Hmgn2. A co-IP was performed using either an antibody (Ab) to FoxJ1 or Dlx2 to pull down endogenous Hmgn2 in LS-8 cells. Endogenous FoxJ1 and Dlx2 directly interacted with Hmgn2 in the LS-8 cells (Fig. 4C). These data demonstrate that HMGN2 can repress the transcriptional activity of two different families of transcription factors.
      Figure thumbnail gr4
      Figure 4HMGN2 represses Dlx2 and FoxJ1 transcriptional activation. A, CHO, LS-8, and 293 cells were cotransfected with the Dlx2 luciferase promoter (5 μg) construct, either Dlx2, HMGN2, or HMGN2 and Dlx2 expression constructs (2.5 μg). β-galactosidase expression construct (0.5 μg) was transfected to control for transfection efficiency. After 48 h, luciferase and β-galactosidase activities were measured. The luciferase activities are shown as mean fold activation compared with the normalized luciferase activity using an empty vector (pcDNA 3.1) with Dlx2 promoter reporter. B, CHO, LS-8, and 293 cells were cotransfected with the FoxJ1 luciferase promoter construct, FoxJ1, HMGN2, or HMGN2 and FoxJ1 expression constructs (2.5 μg). β-galactosidase expression construct (0.5 μg) was transfected to control for transfection efficiency. Experiments were performed as in A. N = 4, ∗p < 0.05. C, coimmunoprecipitation of endogenous FoxJ1, Dlx2, and Hmgn2. LS-8 epithelial cells were harvested, and FoxJ1 Ab or Dlx2 Ab was used to pull down Hmgn2. Hmgn2 protein is shown by Western blot. CHO, Chinese hamster ovary; HMGN2, high mobility group protein N2.

      miR-23a and miR-23b modulate HMGN2 expression

      HMGN2 is required for tight regulation of several transcriptional activities to allow for normal craniofacial/tooth development (
      • Amen M.
      • Liu X.
      • Vadlamudi U.
      • Elizondo G.
      • Diamond E.
      • Engelhardt J.F.
      • et al.
      PITX2 and β-catenin interactions regulate lef-1 isoform expression.
      ,
      • Li X.
      • Venugopalan S.
      • Cao H.
      • Pinho F.
      • Paine M.L.
      • Snead M.L.
      • et al.
      A model for the molecular underpinnings of tooth defects in axenfeld-rieger syndrome.
      ,
      • Wibmuller S.
      • Kosian T.
      • Wolf M.
      • Finzsch M.
      • Wegner M.
      The high-mobility-group domain of Sox proteins interacts with DNA-binding domains of many transcription factors.
      ). In this report, we show that Lef-1 and Pitx2 regulate the Hmgn2 promoter; however, other mechanisms also regulate Hmgn2 expression. To determine if miRs are potential regulators of Hmgn2, we analyzed the 3′UTR sequence of Hmgn2 and found highly conserved miR-23a- and miR-23b-binding elements (Fig. 5A). To determine if miR-23a and miR-23b target Hmgn2 expression in oral epithelial cells, we cloned the Hmgn2 3′UTR containing the miR-23a and miR-23b-binding site into a dual-luciferase reporter and transfected this reporter into LS-8 cells alone or with the constructs to overexpress miR-23a and/or miR-23b. The luciferase activity of WT Hmgn2 3′UTR was significantly repressed by the presence of either miR-23a or/and miR-23b (Fig. 5B). As controls, mutation of the conserved miR-23a+b binding site in the Hmgn2 3′UTR abolished the repression by miR-23a+b (Fig. 5C). Overexpression of miR-23a and miR-23b separately and together leads to reduced endogenous Hmgn2 protein expression in LS-8 cells (Fig. 5D). miR-23a and miR-23b target and repress Hmgn2 expression. However, it is important to show that these miRs are coexpressed with Hmgn2 in the craniofacial/tooth regions of mice during development.
      Figure thumbnail gr5
      Figure 5miR-23a and miR-23b target HMGN2. A, miR-23a and miR-23b are evolutionarily conserved among several vertebrate species, and the potential miR-23a and miR-23b binding sites in the Hmgn2 3′-UTR are highly conserved among different species. B, miR-23a and miR-23b directly target the Hmgn2 3′-UTR. Hmgn2 3′-UTR pGL3 reporter (1 μg) and 2.5 μg pre-miR-23a or miR-23b or empty vector (pSil) were transfected into LS-8 cells. Cells were incubated for 48 h and then assayed for luciferase and β-galactosidase activities. C, miR-23a and miR-23b do not target the Hmgn2 3′ UTR with mutations engineered in the region complementary to the miR-23a and miR-23b seed region. The activities are shown in B and C as mean fold activation compared with luciferase activity with an empty vector (pSil) and normalized to β-galactosidase activity. N = 3, ∗p < 0.05. D, miR-23a and miR-23b repress endogenous HMGN2 expression. Western blot of Hmgn2 protein in control or miR-23a or/and miR-23b precursor transfected LS-8 cells 48 h post-transfection. β-tubulin is shown as a loading control. Mock, pSil-neg vector served as controls. HMGN2, high mobility group protein N2.

      miR-23a+b indirectly activate Pitx2 and amelogenin expression by repressing Hmgn2 expression in dental epithelial cells

      To further understand the regulation of Hmgn2 by miR-23a+b and the contribution to tooth organogenesis, we assayed for miR-23a and miR-23b expression in postnatal (P) P0 and P10 murine molars and incisors. We have previously shown that Hmgn2 expression decreases in these tooth organs at later stages of development (
      • Li X.
      • Venugopalan S.
      • Cao H.
      • Pinho F.
      • Paine M.L.
      • Snead M.L.
      • et al.
      A model for the molecular underpinnings of tooth defects in axenfeld-rieger syndrome.
      ). Here, we show that miR-23a+b expression increases in P10 molars and incisors compared with P0 molars and incisors by miR microarrays (Fig. 6A). Pitx2 regulates amelogenin expression during tooth morphogenesis, and Pitx2 activates the amelogenin promoter (
      • Li X.
      • Venugopalan S.
      • Cao H.
      • Pinho F.
      • Paine M.L.
      • Snead M.L.
      • et al.
      A model for the molecular underpinnings of tooth defects in axenfeld-rieger syndrome.
      ). Here, we show that Pitx2 activation of the amelogenin (Amelo) promoter is increased when miR-23a or miR-23b is coexpressed with Pitx2. HMGN2 can repress Pitx2 activation of the amelogenin promoter, and it appears that miR-23 represses endogenous Hmgn2 expression to allow for increased Pitx2 activation (Fig. 6B).
      Figure thumbnail gr6
      Figure 6miR-23a+b expression correlates with developmental time points and amelogenin expression. A, microRNA microarrays of murine molar and incisor dental epithelium from five biological replicates at P0 and P10 WT embryos show an increase in miR-27 and miR-23 expression at later stages of development. B, transfection of LS-8 cells was performed with the amelogenin (Amelo) luciferase reporter (5 μg), Pitx2, HMGN2, miR-23a, and miR-23b (2.5 μg) expression plasmids. Transfection analyses were performed as previously described ( and ). N = 3, ∗p < 0.05. C, RNAs isolated from E14.5, E16.5, E18.5, P0, P2, and P4 murine mandibles were analyzed by quantitative PCR (qPCR) for HMGN2, miR-23a, miR-23b, and amelogenin transcript levels. Relative levels of each transcript are shown. D, LS-8 cells transduced with lentivirus expressing miR-23b or a scrambled control were analyzed for Hmgn2 and amelogenin expression by immunofluorescence. LS-8 cells expressing miR-23b did not express Hmgn2; however, amelogenin was expressed in these cells compared with control cells. The scale bars represent 50 μm. E, RNA isolated from the LS-8 cells and analyzed by qPCR for Hmgn2, miR-23b, and amelogenin transcript levels. Relative levels of each transcript are shown. N = 3, ∗p < 0.05; ∗∗p < 0.01. HMGN2, high mobility group protein N2.
      Endogenous Hmgn2, miR-23a+b, and amelogenin expression were analyzed during murine mandible/tooth development. RNA was isolated from murine E14.5, E16.5, E18.5, P0, P2, and P4 mandibles, including molars and incisors, and gene expression was determined by quantitative PCR (qPCR). Interestingly, Hmgn2 expression decreases as miR-23a+b expression increases during early development (Fig. 6C). During this time, amelogenin expression increases correlating with amelogenesis and enamel formation (Fig. 6C). In the LS-8 dental epithelial cell line, the detection of Hmgn2 was verified by immunofluorescence and decreased in LS-8 cells overexpressing miR-23b (Fig. 6D). In contrast, amelogenin expression increased in LS-8 cells transduced with miR-23b (Fig. 6D). Transcripts for miR-23b, Hmgn2, and amelogenin were assayed by qPCR for their expression levels in these LS-8 cells. miR-23b-transduced cells had decreased levels of Hmgn2 and increased levels of amelogenin transcripts (Fig. 6E). Thus, as miR-23a+b levels increase, the level of Hmgn2 decreases, thereby allowing for amelogenin expression and enamel formation during tooth development.

      miR-23a+b inhibition of HMGN2 expression increases Dlx2 and FoxJ1 transactivation

      We demonstrated that HMGN2 represses the transcriptional activity of Dlx2 and FoxJ1 in Figure 4. To determine if miR-23a+b expression could also increase Dlx2 and FoxJ1 transactivation of their promoters, we assayed for transcriptional activity in three cell lines. As a control, the Dlx2-luciferase promoter construct was transfected with empty vector and miR-21, which did not affect promoter activation or Dlx2 activation of the promoter (Fig. S2A). Cotransfection of miR-23a and/or miR-23b with Dlx2 significantly increased activation of the Dlx2 promoter in all cell lines (Fig. S2A). Similar results are shown for FoxJ1 activation of the FoxJ1-luciferase promoter construct in the presence of miR-23a and/or miR-23b (Fig. S2B). These results again are consistent with our hypothesis that miR-23 directed inhibition of endogenous Hmgn2, which increases the transcriptional activation of these two transcription factors.
      These experiments were repeated in WT mouse embryo fibroblasts (MEFs) and HMGN2 overexpression transgenic (TG) MEFs. We have previously reported on the phenotype and gene regulation of mice overexpressing HMGN2 (
      • Li X.
      • Venugopalan S.
      • Cao H.
      • Pinho F.
      • Paine M.L.
      • Snead M.L.
      • et al.
      A model for the molecular underpinnings of tooth defects in axenfeld-rieger syndrome.
      ). In these experiments, we asked if miR-23 inhibition of endogenous Hmgn2 and overexpression of HMGN2 in MEFs affected Pitx2 activation of the Lef-1 promoter (Fig. S3A). The Lef-1 promoter-luciferase construct was cotransfected into WT and HMGN2-TG (TG mice overexpressing HMGN2) (
      • Li X.
      • Venugopalan S.
      • Cao H.
      • Pinho F.
      • Paine M.L.
      • Snead M.L.
      • et al.
      A model for the molecular underpinnings of tooth defects in axenfeld-rieger syndrome.
      ) MEFs with Pitx2 and miR-23a and miR-23b. miR-21 was transfected as a control. The miRs alone had no effect on Lef-1 promoter activity (Fig. S3A). Pitx2 activated the Lef-1 promoter at threefold in WT MEFs, and this activation was reduced in MEFs overexpressing HMGN2. Cotransfection of miR-21 as a control miR with Pitx2 had no effect on Pitx2 activation of the Lef-1 promoter in both WT and HMGN2-TG MEFs. Cotransfection of miR-23a, miR-23b, and both miR-23a+b significantly increased Pitx2 activation of the Lef-1 promoter in both WT and HMGN2-TG MEFs (Fig. S3A). Thus, miR-23 was able to inhibit endogenous Hmgn2 expression and facilitate Pitx2 activation of the Lef-1 promoter. The HMGN2 construct used to make the HMGN2-TG mice lacks a 3′UTR and is not regulated by any miRs, and the increase in Pitx2 activation is due to inhibition of endogenous Hmgn2. Thus, the exogenous levels of HMGN2 in the HMGN2-TG MEFs cause a reduced inhibition of the transcription factors compared with WT.
      The same miR-23 effect is shown for Dlx2 activation of the Dlx2 promoter (Fig. S3B) and FoxJ1 activation of the FoxJ1 promoter in both WT MEFs and HMGN2-TG MEFs (Fig. S3C). These data demonstrate that HMGN2 overexpression in MEFs represses the activity of three well-known developmentally regulated transcription factors. Furthermore, miR-23 regulation of Hmgn2 expression indirectly regulates the activity of these important developmental factors.

      H4K5ac and H3K4me2 chromatin factors associate with Pitx2 and Hmgn2 near the Dlx2 transcription start site

      HMGN2 has been shown to bind to DNase I DNA-hypersensitive sites and maintain and open chromatin structure (
      • Martínez de Paz A.
      • Ausió J.
      HMGNs: the enhancer charmers.
      ,
      • Deng T.
      • Zhu Z.
      • Zhang S.
      • Postnikov Y.
      • Huang D.
      • Horsch M.
      • et al.
      Functional compensation among HMGN variants modulates the DNase I hypersensitive sites at enhancers.
      ). Both H4K5ac and H3K4me2 epigenetic factors are associated with open chromatin at transcription start sites (TSSs) and proximal promoter regions (
      • Wang Y.
      • Li X.
      • Hu H.
      H3K4me2 reliably defines transcription factor binding regions in different cells.
      ,
      • Zhao R.
      • Nakamura T.
      • Fu Y.
      • Lazar Z.
      • Spector D.L.
      Gene bookmarking accelerates the kinetics of post-mitotic transcriptional re-activation.
      ). A triple chromatin immunoprecipitation (ChIP) assay was performed, first using the H4K5ac Ab to pull down chromatin bound by this factor, and immunoglobulin G (IgG) only did not immunoprecipitate the initial complex. The complex was washed and followed by a second IP using the Hmgn2 Ab with control IP and a third IP using the Pitx2 Ab with control IP in LS-8 cells. After reverse crosslinking, a qPCR using primers to the indicated proximal Dlx2 promoter sequence amplified a 390 bp product (Fig. S4, A and B; lane 2). Chromatin input is shown in lane 4. As controls, Dlx2 primers alone (lane 3), IgG Ab IP and Dlx2 primers (lane 5), and Pitx2, Hmgn2, and H4K5ac Ab IP with control primers to an upstream region of the Dlx2 promoter were used (Fig. S4B, lane 6). A similar triple ChIP experiment was performed first using the H3K4me2 Ab, followed by the Hmgn2 Ab, and finally with the Pitx2 Ab in LS-8 cells. The indicated proximal Dlx2 promoter sequence was amplified using the specific primers (Fig. S4C, lane 2). Chromatin input is shown in lane 4. As controls, Dlx2 primers alone and IgG Ab IP with Dlx2 primers are shown (Fig. S4C, lanes 3 and 5, respectively). While there are multiple Pitx2-binding sites in the Dlx2 promoter sequence, we have previously reported that when Pitx2 is bound to HMGN2, Pitx2 is not bound to DNA, but upon interaction with Wnt signaling and direct interaction with β-cat, Pitx2 is released from chromatin-bound HMGN2, and Pitx2 binds directly to TAATCC-binding elements in specific promoters (
      • Amen M.
      • Liu X.
      • Vadlamudi U.
      • Elizondo G.
      • Diamond E.
      • Engelhardt J.F.
      • et al.
      PITX2 and β-catenin interactions regulate lef-1 isoform expression.
      ). Thus, we show that Hmgn2, which is bound to chromatin (marked by H4K5ac and H3K4me2), binds to Pitx2 in a chromatin complex (
      • Amen M.
      • Liu X.
      • Vadlamudi U.
      • Elizondo G.
      • Diamond E.
      • Engelhardt J.F.
      • et al.
      PITX2 and β-catenin interactions regulate lef-1 isoform expression.
      ).

      Hmgn2 is developmentally regulated and controls dental epithelial cell proliferation

      Hmgn2+/− mice expressing LacZ were X-gal stained, and whole embryos from E10.5 to P0 were analyzed by light microscopy (Fig. 7A). Hmgn2 LacZ has high expression levels during early developmental stages and gradually decreases prior to birth. These data are consistent with our previous report showing that Hmgn2 transcripts decrease during later embryonic stages (
      • Li X.
      • Venugopalan S.
      • Cao H.
      • Pinho F.
      • Paine M.L.
      • Snead M.L.
      • et al.
      A model for the molecular underpinnings of tooth defects in axenfeld-rieger syndrome.
      ). We study craniofacial and tooth development, and a diagram of the developing lower incisor at E16.5 is shown depicting the lingual cervical loop and labial cervical loop (LaCL) and dental epithelia (Fig. 7B). Hmgn2 is expressed in the developing murine lower incisor at E14.5 (Fig. 7C) but is absent from the Hmgn2−/− E14.5 embryos (Fig. 7D).
      Figure thumbnail gr7
      Figure 7HMGN2 LacZ expression decreases during development and regulates cell proliferation. A, Hmgn2+/− whole embryos expressing LacZ were stained for X-gal expression and visualized by light microscopy. B, diagram of murine lower incisor development at E16.5 and the mature murine mandible. C and D, WT and Hmgn2−/− E14.5 embryo lower incisor sections were incubated with Hmgn2 antibody (Ab) and visualized using a secondary immunofluorescence Ab to detect Hmgn2 expression. E and F, E16.5 WT and Hmgn2−/− embryo lower incisor sections, respectively, were incubated with Ki67 Ab and visualized using a secondary immunofluorescence Ab to detect Ki67 expression. G and H, P0 WT and Hmgn2−/− embryo lower incisor sections, respectively, were incubated with Ki67 Ab and visualized using a secondary immunofluorescence Ab to detect Ki67 expression. The regions denoted by the dotted square were magnified (I and J) to show the LaCL and transient amplifying cell (TAC) region. The scale bars represent 100 μm. K, quantification using ImageJ of Ki67+ cells shows an increase in cell proliferation in the Hmgn2 KO embryos. DESC, dental epithelial stem cell; HMGN2, high mobility group protein N2; LaCL, labial cervical loop; LI, lower incisor; LiCL, lingual cervical loop; Md, mandible; Tn, tongue.
      We next determined if dental epithelial cell proliferation was affected in the lower incisor of Hmgn2−/− embryos. We have previously shown that Pitx2 and Lef-1 control dental epithelial cell proliferation and differentiation (
      • Sun Z.
      • Yu W.
      • Sanz Navarro M.
      • Sweat M.
      • Eliason S.
      • Sharp T.
      • et al.
      Sox2 and Lef-1 interact with Pitx2 to regulate incisor development and stem cell renewal.
      ,
      • Sweat Y.Y.
      • Sweat M.
      • Yu W.
      • Sanz-Navarro M.
      • Zhang L.
      • Sun Z.
      • et al.
      Sox2 controls periderm and rugae development to inhibit oral adhesions.
      ,
      • Eliason S.
      • Sharp T.
      • Sweat M.
      • Sweat Y.Y.
      • Amendt B.A.
      Ectodermal organ development is regulated by a microRNA-26b-lef-1-Wnt signaling Axis.
      ). Our hypothesis is that the loss of Hmgn2 would increase the transcriptional activity of factors involved in dental epithelial cell proliferation and differentiation. Immunofluorescence staining of the cell proliferation marker, Ki67, was performed in sagittal sections of E16.5 and P0 Hmgn2−/− and WT murine lower incisors. E16.5 Hmgn2−/− embryos revealed an increase in progenitor cell and transient amplifying cell (TAC) proliferation in the LaCL (stem cell niche) and lingual cervical loop compared with WT embryos (Fig. 7, E and F). At P0 dental epithelial cell, proliferation is mainly confined to the TAC region in WT embryos (Fig. 7, G and H). However, in the P0 Hmgn2−/− embryos, cell proliferation was present in the LaCL (Fig. 7,I and J). In normal incisor development and growth, cells exit the LaCL, migrating to the TAC region, where they proliferate and begin differentiation to ameloblast cells. Quantitation of Ki67+ cells in the dental epithelium shows an increase in proliferative cells (Fig. 7K). The lack of Hmgn2 protein appears to stimulate premature and prolonged cell proliferation in the LaCL.

      HMGN2−/− murine incisors have increased amelogenin and enamel formation

      To investigate if dental epithelial cell gene expression was affected in Hmgn2−/− murine incisors, we analyzed several markers of dental epithelium. E-cadherin, highly expressed in undifferentiated dental epithelium (
      • Biehs B.
      • Hu J.K.
      • Strauli N.B.
      • Sangiorgi E.
      • Jung H.
      • Heber R.P.
      • et al.
      BMI1 represses Ink4a/Arf and Hox genes to regulate stem cells in the rodent incisor.
      ), remained unchanged between WT and Hmgn2−/− incisors (data not shown). Amelogenin, which is the most abundant (90%) enamel matrix protein and critical for enamel development, is normally expressed in secretory stage ameloblasts in the anterior region of incisor at P0 (Fig. 8, A and C). However, amelogenin expression was expanded toward the posterior (Pos) region of the incisors in Hmgn2−/− mice, suggesting ablation of Hmgn2 results in increasing/expanded amelogenin expression in teeth (Fig. 8, B and D). Trichrome staining at the P4 stage to mark the enamel and dentin in incisors also revealed that the enamel layer in Hmgn2−/− mice was expanded posteriorly compared with WT (Fig. 8, EH). These data showing increased amelogenin expression and enamel formation in Hmgn2−/− mice are consistent with Hmgn2 acting as a repressor for Pitx2, Lef-1, Dlx2, and FoxJ1 activation of amelogenin expression. In addition, dentin sialo phosphoprotein (DSPP) was increased in the posterior preameloblast region of the P2 Hmgn2−/− incisors (Fig. 8,I and J). DSPP is transiently expressed in the ameloblasts cells and mainly confined to odontoblasts. Consistent with an increase in cell proliferation and amelogenin expression in the posterior region of the incisor, increased DSPP expression may also indicate an increase in cell differentiation in the anterior region of the Hmgn2−/− lower incisor.
      Figure thumbnail gr8
      Figure 8Hmgn2−/− incisors have increased amelogenin expression and enamel formation. A and B, amelogenin immunofluorescence staining in lower incisors from P0 WT and Hmgn2−/− mice. C and D, magnified images from boxed region in A and B highlight the amelogenin expression in presecretory ameloblast. Note that amelogenin expression moved further proximally in the incisors in Hmgn2−/− mice. E and F, images of trichrome-stained lower incisors from P4 WT and Hmgn2−/− mice, respectively. Note, the enamel was stained as dark red, and dentin was stained as blue. G and H, higher magnified pictures of boxed regions in E and F. In P4 Hmgn2−/− mice, enamel deposition occurs more proximally in the incisor. I and J, immunofluorescence staining of Dspp in P2 WT and Hmgn2−/− mice, respectively. Nuclei are counterstained with DAPI. The scale bars represent 100 μm AM, ameloblast; D, dentin; DAPI, 4′,6-diamidino-2-phenylindole; Dis, distal; Dspp, dentin sialo phosphoprotein; E, enamel; HMGN2, high mobility group protein N2; OD, odontoblast; preAM, presecretory ameloblast; Pro, proximal.

      Discussion

      In this report, we demonstrate the role of HMGN2 in regulating transcription factor activity and gene expression. We first reported the ability of HMGN2 to bind Pitx2, a developmentally regulated homeodomain transcription factor (
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ). HMGN2 can remove Pitx2 from bound DNA to form an inactive transcriptional complex. We demonstrated that upon interaction with β-cat, the Pitx2–β-cat complex binds to Pitx2 enhancer elements to activate transcription (
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ). We proposed that HMGN2 binds to open chromatin complexed with Pitx2 poised to activate transcription when Wnt signaling is active (
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ). In a subsequent report, we demonstrated a role for HMGN2 in tooth development using a Krt-14 promoter–driven HMGN2 overexpression TG mouse (
      • Li X.
      • Venugopalan S.
      • Cao H.
      • Pinho F.
      • Paine M.L.
      • Snead M.L.
      • et al.
      A model for the molecular underpinnings of tooth defects in axenfeld-rieger syndrome.
      ). We now show that HMGN2 regulates several developmentally regulated transcription factors and that HMGN2 can regulate Lef-1 DNA binding similar to Pitx2. In addition, we analyzed the Hmgn2−/− embryos for defects in tooth development.
      More recent publications describe the conformation changes in the nucleosomes upon binding of HMGN1 and HMGN2 (
      • Murphy K.J.
      • Cutter A.R.
      • Fang H.
      • Postnikov Y.V.
      • Bustin M.
      • Hayes J.J.
      HMGN1 and 2 remodel core and linker histone tail domains within chromatin.
      ). HMGN2 binding to nucleosomes causes rearrangements of core and linker histone tail interactions leading to a less condensed chromatin structure (
      • Murphy K.J.
      • Cutter A.R.
      • Fang H.
      • Postnikov Y.V.
      • Bustin M.
      • Hayes J.J.
      HMGN1 and 2 remodel core and linker histone tail domains within chromatin.
      ,
      • Martínez de Paz A.
      • Ausió J.
      HMGNs: the enhancer charmers.
      ,
      • Rochman M.
      • Postnikov Y.
      • Correll S.
      • Malicet C.
      • Wincovitch S.
      • Karpova T.S.
      • et al.
      The interaction of NSBP1/HMGN5 with nucleosomes in euchromatin counteracts linker histone-mediated chromatin compaction and modulates transcription.
      ,
      • Rattner B.P.
      • Yusufzai T.
      • Kadonaga J.T.
      HMGN proteins act in opposition to ATP-dependent chromatin remodeling factors to restrict nucleosome mobility.
      ).

      HMGN2 regulates Lef-1 DNA binding and transcriptional activity through an interaction with the Lef-1 HMG-box domain

      Many reports have shown that either HMGN proteins or proteins containing HMG-binding domains act through protein interaction or chromatin-binding domains (
      • Shirakawa H.
      • Herrera J.E.
      • Bustin M.
      • Postnikov Y.
      Targeting of high mobility group-14-17 proteins in chromatin is independent of DNA sequence.
      ,
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ,
      • Sun Z.
      • Yu W.
      • Sanz Navarro M.
      • Sweat M.
      • Eliason S.
      • Sharp T.
      • et al.
      Sox2 and Lef-1 interact with Pitx2 to regulate incisor development and stem cell renewal.
      ,
      • Li X.
      • Venugopalan S.
      • Cao H.
      • Pinho F.
      • Paine M.L.
      • Snead M.L.
      • et al.
      A model for the molecular underpinnings of tooth defects in axenfeld-rieger syndrome.
      ,
      • Wibmuller S.
      • Kosian T.
      • Wolf M.
      • Finzsch M.
      • Wegner M.
      The high-mobility-group domain of Sox proteins interacts with DNA-binding domains of many transcription factors.
      ,
      • Rochman M.
      • Postnikov Y.
      • Correll S.
      • Malicet C.
      • Wincovitch S.
      • Karpova T.S.
      • et al.
      The interaction of NSBP1/HMGN5 with nucleosomes in euchromatin counteracts linker histone-mediated chromatin compaction and modulates transcription.
      ,
      • Fiorillo A.A.
      • Medler T.R.
      • Feeney Y.B.
      • Liu Y.
      • Tommerdahl K.L.
      • Clevenger C.V.
      HMGN2 inducibly binds a novel transactivation domain in nuclear PRLr to coordinate Stat5a-mediated transcription.
      ,
      • Furusawa T.
      • Lim J.-H.
      • Catez F.
      • Birger Y.
      • Mackem S.
      • Bustin M.
      Down-regulation of nucleosomal binding protein HMGN1 expression during embryogenesis modulates Sox9 expression in chondrocytes.
      ,
      • Zhu X.
      • Gleiberman A.S.
      • Rosenfeld M.G.
      Molecular physiology of pituitary development: signaling and transcriptional networks.
      ,
      • Hock R.
      • Furusawa T.
      • Ueda T.
      • Bustin M.
      HMG chromosomal proteins in development and disease.
      ). We demonstrate that Lef-1, a HMG-box domain–containing transcription factor, directly interacts with HMGN2 in the cell nucleus, using a BiFC assay. This interaction represses Lef-1 transcriptional activation of gene expression. We further demonstrate that similar to Pitx2 the repressive effect of HMGN2 on Lef-1 transcriptional activity is relieved by cotransfection of β-cat. We show that the HMG-box domain of Lef-1 directly interacts with HMGN2. IP experiments further show that HMGN2 interacts with a Lef-1–β-cat protein complex.
      We identified a unique function of HMGN2 in its ability to bind to and remove Lef-1 from DNA, similar to its interaction with Pitx2 (
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ). Titration of HMGN2 protein in an EMSA experiment to Lef-1 bound to DNA effectively removed Lef-1 from DNA (Fig. 3). There are very few proteins with this molecular function, and HMGN2 appears to tightly control the transcriptional activity of several factors by this mechanism.
      Interestingly, both Lef-1 and Pitx2 activate the Hmgn2 promoter, and HMGN2 represses their transactivation activity as expected. Addition of β-cat derepresses the action of HMGN2 and restores the transcriptional activity of these factors. This corroborates our previous finding that HMGN2 forms an inactive transcriptional complex with transcription factors and upon Wnt signaling and interaction with β-cat converts the inactive complex to an active transcriptional complex (
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ).

      HMGN2 regulates the transcriptional activity of multiple factors

      HMGN2 has been reported to interact with other proteins but not at the transcriptional level. Because Lef-1 transcriptional activity was shown to be regulated by HMGN2, two other developmentally regulated transcription factors were also shown to be repressed by HMGN2 in promoter assays. Both Dlx2 and FoxJ1 are transcription factors involved in craniofacial and tooth development (
      • Cox C.J.
      • Espinoza H.M.
      • McWilliams B.
      • Chappell K.
      • Morton L.
      • Hjalt T.A.
      • et al.
      Differential regulation of gene expression by PITX2 isoforms.
      ,
      • Diamond E.
      • Amen M.
      • Hu Q.
      • Espinoza H.M.
      • Amendt B.A.
      Functional interactions between Dlx2 and lymphoid enhancer factor regulate Msx2.
      ,
      • Green P.D.
      • Hjalt T.A.
      • Kirk D.E.
      • Sutherland L.B.
      • Thomas B.L.
      • Sharpe P.T.
      • et al.
      Antagonistic regulation of Dlx2 expression by PITX2 and Msx2: implications for tooth development.
      ,
      • Venugopalan S.R.
      • Amen M.A.
      • Wang J.
      • Wong L.
      • Cavender A.C.
      • D'Souza R.N.
      • et al.
      Novel expression and transcriptional regulation of FoxJ1 during oro-facial morphogenesis.
      ,
      • Venugopalan S.R.
      • Li X.
      • Amen M.A.
      • Florez S.
      • Gutierrez D.
      • Cao H.
      • et al.
      Hierarchical interactions of homeodomain and forkhead transcription factors in regulating odontogenic gene expression.
      ). Both genes play major roles in tissue-specific development and embryogenesis. Furthermore, Hmgn2 is considered a major regulator of the timing of early embryonic development in the mouse (
      • Mohamed O.A.
      • Bustin M.
      • Clarke H.J.
      High-mobility group proteins 14 and 17 maintain the timing of early embryonic development in the mouse.
      ). Hmgn2 repression of Dlx2 and FoxJ1 is cell independent as three different cell lines were used to demonstrate the repressive effect of Hmgn2 on Dlx2 and FoxJ1 activity.

      HMGN2 expression is controlled by miRs

      Hmgn2 expression occurs during early mouse embryogenesis, and this expression decreases as development proceeds (
      • Lehtonen S.
      • Olkkonen V.M.
      • Stapleton M.
      • Zerial M.
      • Lehtonen E.
      HMG-17, a chromosomal non-histone protein, shows developmental regulation during organogenesis.
      ,
      • Li X.
      • Venugopalan S.
      • Cao H.
      • Pinho F.
      • Paine M.L.
      • Snead M.L.
      • et al.
      A model for the molecular underpinnings of tooth defects in axenfeld-rieger syndrome.
      ,
      • Furusawa T.
      • Lim J.-H.
      • Catez F.
      • Birger Y.
      • Mackem S.
      • Bustin M.
      Down-regulation of nucleosomal binding protein HMGN1 expression during embryogenesis modulates Sox9 expression in chondrocytes.
      ,
      • Lehtonen S.
      • Lehtonen E.
      HMG-17 is an early marker of inductive interactions in the developing mouse kidney.
      ). Hmgn2 is highly expressed throughout the entire embryo and decreased at birth. Several mechanisms could explain that Hmgn2 reduced expression as embryonic development ends, including post-transcriptional epigenetic factors. miRs are involved in the modulation of temporal-spatial gene expression, and we show that as miR-23 expression increases, Hmgn2 expression decreases. miR-23 indirectly regulates genes that are directly controlled by HMGN2 by binding to the HMGN2 3′UTR. We demonstrate a new mechanism for controlling gene expression during development where HMGN2 regulates multiple transcription factors required for several developmental processes. However, mechanisms are required to derepress the activity of Hmgn2 to activate transcription factors required for normal embryonic development. Thus, the expression of miR-23 is required to allow for dental epithelium cell differentiation by repressing Hmgn2 expression (Fig. 9A).
      Figure thumbnail gr9
      Figure 9Models for the role of HMGN2, chromatin marks and miR-23a+b in the regulation of gene expression. A, a feedback loop occurs where Pitx2, Lef-1, and β-catenin activates HMGN2 expression and then represses HMGN2 Pitx2 and Lef-1 transcriptional activity as well as other factors, miR-23 expression allows for the repression of HMGN2 expression so transcription factors can activate tissue-specific genes. This mechanism fine tunes HMGN2 expression during development. Pitx2, Lef-1, FoxJ1, Dlx2, and β-catenin regulate genes required for dental epithelial cell differentiation, amelogenin expression, and ameloblast differentiation, which, leads to enamel mineralization. However, HMGN2 represses the transcriptional activity of these factors, and miR-23a+b then acts at later stages of development to repress HMGN2 expression and facilitate enamel formation. B, inactive HMGN2/Pitx2 transcription factor (TF) complex binds to H4K5ac and/or H3K4me2 histone marks in the chromatin. Specific cofactors release the inactive complex from chromatin as an active complex, which can bind specifically to DNA enhancers and activate transcription of target genes (
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ). HMGN2, high mobility group protein N2.

      HMGN2 associates with open chromatin and the Pitx2 transcription factor to activate gene expression

      HMGN proteins have emerged as essential regulators of transcription. Their interactions with nucleosomes and histones to regulate chromatin structure and the rates of transcription are required for development (
      • Shirakawa H.
      • Herrera J.E.
      • Bustin M.
      • Postnikov Y.
      Targeting of high mobility group-14-17 proteins in chromatin is independent of DNA sequence.
      ,
      • Bustin M.
      Chromatin unfolding and activation by HMGN∗ chromosomal proteins.
      ,
      • Trieschmann L.
      • Postnikov Y.V.
      • Rickers A.
      • Bustin M.
      Modular structure of chromosomal proteins HMG-14 and HMG-17; definition of a transcriptional activation domain distinct from the nucleosomal binding domain.
      ,
      • Catez F.
      • Yang H.
      • Tracey K.J.
      • Reeves R.
      • Misteli T.
      • Bustin M.
      Network of dynamic interactions between histone H1 and high-mobility-group proteins in chromatin.
      ,
      • Phair R.D.
      • Mistell T.
      High mobility of proteins in the mammalian cell nucleus.
      ,
      • Rochman M.
      • Postnikov Y.
      • Correll S.
      • Malicet C.
      • Wincovitch S.
      • Karpova T.S.
      • et al.
      The interaction of NSBP1/HMGN5 with nucleosomes in euchromatin counteracts linker histone-mediated chromatin compaction and modulates transcription.
      ,
      • Hock R.
      • Furusawa T.
      • Ueda T.
      • Bustin M.
      HMG chromosomal proteins in development and disease.
      ,
      • Bustin M.
      • Neihart N.K.
      Antibodies against chromosomal HMG proteins stain the cytoplasm of mammalian cells.
      ,
      • Lim J.-H.
      • West K.L.
      • Rubinstein Y.
      • Bergel M.
      • Postnikov Y.V.
      • Bustin M.
      Chromosomal protein HMGN1 enhances the acetylation of lysine 14 in histone H3.
      ). How these HMGN proteins recruit and activate gene expression remains unresolved, and our research provides an initial understanding of their transcriptional mechanisms. At the proximal promoter, two chromatin factors (H4K5ac and H3K4me2) are shown to be deposited and associated with active transcription (
      • Wang Y.
      • Li X.
      • Hu H.
      H3K4me2 reliably defines transcription factor binding regions in different cells.
      ,
      • Zhao R.
      • Nakamura T.
      • Fu Y.
      • Lazar Z.
      • Spector D.L.
      Gene bookmarking accelerates the kinetics of post-mitotic transcriptional re-activation.
      ). These epigenetic factors are associated with transcription factor–binding regions. We demonstrate that the Hmgn2–Pitx2 complex is associated with either H4K5ac or H3K4me2 in a transcription factor–binding region poised to activate transcription (Fig. S4). It is well known that HMGN2 binds to histones and linker tails to open chromatin. Thus, we propose that the interaction of HMGN2 with chromatin, epigenetic marks, and transcription factors recruits the transcription factor to transcription factor–binding regions in open chromatin ready to activate gene expression upon stimuli such as Wnt/β-cat signaling (Fig. 9B) (
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ).

      Pitx2 and Lef-1 activate HMGN2, and HMGN2 feeds back to repress their transcriptional activities

      HMGN2 expression is differentially regulated during development as it is highly expressed during early tooth development and morphogenesis. HMGN2 acts to repress the transcriptional activities of genes during these early stages of progenitor cell proliferation, so these progenitor cells do not prematurely differentiate. However, as development proceeds, HMGN2 must be downregulated to generate the different stages of ameloblast differentiation and amelogenin expression to form enamel and the mature tooth. At later stages, miR-23 expression increases to repress HMGN2, which allows for Pitx2, Lef-1, Dlx2, and FoxJ1 to activate genes required for ameloblast differentiation. HMGN2 plays a unique role in regulating the switch between proliferation and differentiation by directly interacting with and modulating the transcriptional activity of several genes.

      HMGN2 is required for normal tooth development

      HMGN2 modulates genes required for tooth development and differentiation as shown previously and, in this report, (
      • Li X.
      • Venugopalan S.
      • Cao H.
      • Pinho F.
      • Paine M.L.
      • Snead M.L.
      • et al.
      A model for the molecular underpinnings of tooth defects in axenfeld-rieger syndrome.
      ). Hmgn2 expression is developmentally regulated and modulates both cell proliferation in the murine lower incisor as well as amelogenin and Dspp expression. Amelogenin is required for enamel formation, and an increase in enamel formation was observed in the Hmgn2-null mice as well as an increase in Dspp expression. Thus, it appears that Hmgn2 controls cell differentiation in the lower incisor by regulating Dlx2, Pitx2, Lef-1, and FoxJ1 transcription factors, which are all known to regulate epithelial cell differentiation and amelogenesis (
      • Li X.
      • Venugopalan S.
      • Cao H.
      • Pinho F.
      • Paine M.L.
      • Snead M.L.
      • et al.
      A model for the molecular underpinnings of tooth defects in axenfeld-rieger syndrome.
      ,
      • Cox C.J.
      • Espinoza H.M.
      • McWilliams B.
      • Chappell K.
      • Morton L.
      • Hjalt T.A.
      • et al.
      Differential regulation of gene expression by PITX2 isoforms.
      ,
      • Diamond E.
      • Amen M.
      • Hu Q.
      • Espinoza H.M.
      • Amendt B.A.
      Functional interactions between Dlx2 and lymphoid enhancer factor regulate Msx2.
      ,
      • Green P.D.
      • Hjalt T.A.
      • Kirk D.E.
      • Sutherland L.B.
      • Thomas B.L.
      • Sharpe P.T.
      • et al.
      Antagonistic regulation of Dlx2 expression by PITX2 and Msx2: implications for tooth development.
      ,
      • Venugopalan S.R.
      • Amen M.A.
      • Wang J.
      • Wong L.
      • Cavender A.C.
      • D'Souza R.N.
      • et al.
      Novel expression and transcriptional regulation of FoxJ1 during oro-facial morphogenesis.
      ,
      • Venugopalan S.R.
      • Li X.
      • Amen M.A.
      • Florez S.
      • Gutierrez D.
      • Cao H.
      • et al.
      Hierarchical interactions of homeodomain and forkhead transcription factors in regulating odontogenic gene expression.
      ).
      These data demonstrate a unique role for Hmgn2 in the development of enamel formation through the regulation of multiple transcription factors. Furthermore, we have identified a new role for miR-23 and epigenetic marks in modulating Hmgn2 activity. The early embryonic expression of Hmgn2 suggests that it plays a role in modulating transcription factor activity during developmental stages. Hmgn2 may orchestrate the ability of multiple factors to regulate gene expression in a temporal–spatial mechanism. Interestingly, after birth, Hmgn2 is downregulated and does not appear to be required for homeostasis. We show a role for Hmgn2 during tooth development; however, it is also required for other tissue/organ development. We speculate that the gene expression mechanisms reported in these experiments are also important for other tissue/organ developmental mechanisms.

      Experimental procedures

      Mouse strain breeding

      All animals were housed, and all procedures were performed in accordance with the guidelines approved by the University of Iowa Office of Animal Care. All experimental procedures were approved in accordance with the University of Iowa Institutional Animal Care and Use Committee guidelines. The Hmgn2−/− mice were generated from (Hmgn2tm1b(KOMP)Wtsi) knockout embryonic stem cells obtained from KOMP repository. The Pitx2 TG mouse was previously described (
      • Li X.
      • Venugopalan S.
      • Cao H.
      • Pinho F.
      • Paine M.L.
      • Snead M.L.
      • et al.
      A model for the molecular underpinnings of tooth defects in axenfeld-rieger syndrome.
      ).

      miR microarray

      Incisor and molar tooth germs were dissected from P0 and P10 mice using a dissection microscope. To separate epithelium and mesenchyme, the tooth germs were treated with dispase II and collagenase I (Worthington) for 30 min at 37 °C. This procedure separates the epithelium from the mesenchyme and allows for specific RNA extraction of the two tissue types (
      • Cao H.
      • Wang J.
      • Li X.
      • Florez S.
      • Huang Z.
      • Venugopalan S.R.
      • et al.
      MicroRNAs play a critical role in tooth development.
      ). Total RNAs including miR were prepared using miRNeasy Mini Kit from Qiagen. LC Sciences performed the miR microarray analyses.

      BiFC assay

      The BiFC assay was performed as previously reported (
      • Zhang Z.
      • Gutierrez D.
      • Li X.
      • Wang J.
      • Andrade K.
      • Amendt B.A.
      Homeodomain transcription factor Lhx6: a transcriptional repressor that interacts with PITX2 to regulate odontogenesis.
      ). Lef-1 complementary DNA was cloned into the pFLAG-CMV-2 plasmid (Sigma) containing an N-terminal fragment of EYFP, and HMGN2 was ligated to a C-terminal fragment of EYFP in the pFLAG-CMV-2 plasmid as shown in Figure 1A. YN or YC fragments only were ligated into the vector and used as negative controls. One microgram of each construct was transfected into HEK-293 cells. After 24 h, Nikon 80i fluorescence microscope was used to detect the fluorescence.

      Fluorescence immunocytochemistry

      Approximately 5000 cells were seeded on glass slides 24 h prior to fixation. The slides were washed in 1× PBS and then incubated in ice-cold acetone for 5 min at 4 °C. Fixed cells were washed twice with PBS with Tween 20 (PBST) (5 min each). Subsequently, the slides were incubated in 10% normal goat serum–PBST for 30 min at room temperature for blocking. Slides were then incubated with either amelogenin Ab (Santa Cruz; 1:500 dilution), KI67 Ab (Abcam; 1:500 dilution), or HMGN2 Ab (Cell Signaling; 1:5000 dilution) at 4 °C overnight. Cells were rinsed with PBST three times, 10 min each, and were incubated with goat anti-rabbit Alexa-488-labeled secondary Ab (Invitrogen) for 30 min at 37 °C. Finally, the cells were washed with PBST three times, 10 min each, and counterstained using a mounting solution containing 4′,6-diamidino-2-phenylindole.

      LacZ staining

      Embryos or postnatal pups of different stages were fixed for 20 to 40 min at room temperature in the fix solution (0.2% glutaraldehyde, 2% formaldehyde, 2 mM MgCl2, 5 mM EDTA [pH 8.0], and 100 mM NaH2PO4 [pH 7.3]) and washed three times in rinse solution (0.2% Nonidet P-40 and 0.1% sodium deoxycholate, 100 mM NaH2PO4 [pH 7.3], and 2 mM MgCl2). Embryos were stained for 24 to 48 h at 37 °C in staining solution (1.65 mg/ml potassium ferricyanide, 1.84 mg/ml potassium ferrocyanide, 2 mM MgCl2, and 1 mg/ml X-gal in rinse solution), rinsed in PBS, and postfixed in 4% paraformaldehyde (PFA).

      Histology, fluorescent immunohistochemistry, and trichrome staining

      Murine embryos or postnatal pups were used for histology and fluorescence immunohistochemistry. Samples were fixed in 4% PFA, dehydrated, and embedded in paraffin. Sections were cut to 7 μm thickness and standard hematoxylin and eosin staining to assess tissue morphology. Sections that were used for fluorescence immunohistochemistry were rehydrated and treated with 10 mM sodium citrate solution for 20 min at a slow boil for antigen retrieval. These sections were incubated with 10% goat serum–PBST for 30 min at room temperature, followed by overnight incubation at 4 °C with an Ab against one of the following proteins: amelogenin (Santa Cruz; 1:200 dilution), Hmgn2 (Millipore; 1:500 dilution), Ameb (Santa Cruz; 1:200 dilution), Enml (Santa Cruz; 1:200 dilution), Ki67 (Abcam; 1:250 dilution), E-cadherin (BD Bioscience; 1:200 dilution), or Dspp (Santa Cruz; 1:200 dilution). After the incubation, the slides were treated with Alexa-488 (FITC channel) or Alexa-555 (Cy3 channel)–labeled secondary Ab (Invitrogen) at a concentration of 1:500 for 30 min. Each Ab incubation was followed by 3 to 6 PBST washes. Nuclear counterstaining was performed by applying a 4′,6-diamidino-2-phenylindole–containing mounting solution after the final wash (Vector Laboratories). The trichrome staining was carried out as previously described (
      • Cao H.
      • Wang J.
      • Li X.
      • Florez S.
      • Huang Z.
      • Venugopalan S.R.
      • et al.
      MicroRNAs play a critical role in tooth development.
      ). Samples were stained with azocarmin for 1 h at 50 °C and then stained with aniline to differentiate nuclei. Finally, samples were stained with Orange G and Aniline blue for 2 h.

      Expression and luciferase reporter constructs

      Pitx2A, Pitx2C, and HMGN2 complementary DNA were cloned into pcDNA-3.1-MycHisC (Invitrogen) using cytomegalovirus (CMV) promoter to allow expression in eukaryotic cells. miR-23a and miR-23b were cloned into pSilencer 4.1 (Life Technologies). A 5.3 kb upstream of Pitx2 TSS and 2.2 kb upstream of amelogenin TSS were cloned into pTK-Luc vectors to generate the promoter luciferase reporters.
      The Hmgn2 3′UTR was ligated to downstream of a luciferase gene in pGL3 reporter vector (Promega). PCR-driven overlap extension method was used to mutate the miR23-a/b–binding site in Hmgn2 3′UTR (AAUGUGA to CCGAGAC). β-cat, Foxj1, Dlx2, Lef-1, Pitx2, and HMGN2 expression constructs have been previously reported (
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ,
      • Vadlamudi U.
      • Espinoza H.M.
      • Ganga M.
      • Martin D.M.
      • Liu X.
      • Engelhardt J.F.
      • et al.
      PITX2, β-catenin, and LEF-1 interact to synergistically regulate the LEF-1 promoter.
      ,
      • Amen M.
      • Liu X.
      • Vadlamudi U.
      • Elizondo G.
      • Diamond E.
      • Engelhardt J.F.
      • et al.
      PITX2 and β-catenin interactions regulate lef-1 isoform expression.
      ,
      • Cox C.J.
      • Espinoza H.M.
      • McWilliams B.
      • Chappell K.
      • Morton L.
      • Hjalt T.A.
      • et al.
      Differential regulation of gene expression by PITX2 isoforms.
      ,
      • Green P.D.
      • Hjalt T.A.
      • Kirk D.E.
      • Sutherland L.B.
      • Thomas B.L.
      • Sharpe P.T.
      • et al.
      Antagonistic regulation of Dlx2 expression by PITX2 and Msx2: implications for tooth development.
      ,
      • Venugopalan S.R.
      • Amen M.A.
      • Wang J.
      • Wong L.
      • Cavender A.C.
      • D'Souza R.N.
      • et al.
      Novel expression and transcriptional regulation of FoxJ1 during oro-facial morphogenesis.
      ). All the cloned constructs were confirmed by DNA sequencing. All plasmids used for transfection were purified by double banding in cesium chloride.

      Cell culture, transfections, and reporter assays

      LS-8 (
      • Chen L.S.
      • Couwenhoven R.I.
      • Hsu D.
      • Luo W.
      • Snead M.L.
      Maintenance of amelogenin gene expression by transformed epithelial cells of mouse enamel organ.
      ), HEK-293, and CHO cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin and transfected by electroporation. MEFs were isolated and cultured from E16.5 WT and HMGN2 TG embryos. Cells were resuspended in PBS and mixed with 2.5 μg of expression plasmid, 5 μg of reporter plasmid, and 0.2 μg of SV-40 β-galactosidase plasmid. Transfection was performed by electroporation at 380 V and 950 mF (Gene Pulser XL; Bio-Rad) or using the Lipofectamine 2000 (Life Technologies) transfection reagent. Transfected cells were incubated in 60 mm culture dishes, for 24 h unless otherwise indicated, and fed with 10% fetal bovine serum and Dulbecco's modified Eagle's medium. Following lysis, assays for reporter activity (luciferase assay; Promega) as well as for protein concentration (Bradford assay; Bio-Rad) were carried out. β-galactosidase was measured using the Galacto-Light Plus reagents (Tropix, Inc) as an internal normalizer. For each assay, all luciferase activities were normalized to the mean value of the first experimental group and are shown as mean ± SEM.

      EMSA

      Complementary oligonucleotides containing a Lef-1-binding site within the Dlx2 promoter with flanking partial BamHI ends were annealed and filled with Klenow polymerase to generate 32P-labeled probes for EMSAs as described (
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ). Standard binding assays were performed as previously described (
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ). A titration of the bacteria expressed and purified HMGN2 protein was used in the assays. Lef-1 purified protein was allowed to bind to the probe for 15 min, after which purified HMGN2 protein was titrated and added to the binding reaction. The samples were electrophoresed, visualized, and quantitated as described previously (
      • Amen M.
      • Espinoza H.M.
      • Cox C.
      • Liang X.
      • Wang J.
      • Link T.M.
      • et al.
      Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
      ).

      Western blot assays

      Cell lysates were analyzed on 12% SDS-PAGE gels. Following electrophoresis, the protein was transferred to polyvinylidene difluoride membrane (Millipore), immunoblotted, and detected with a horseradish peroxidase–conjugated secondary Ab and ECL reagents from GE Healthcare/Amersham Biosciences. The following polyclonal Abs were used to detect the proteins: anti-β-tubulin (1:1000 dilution; Santa Cruz Biotechnology), anti-Pitx2 (1:500 dilution; Capra Science), and Hmgn2 (1:500 dilution; Millipore).

      Real-time PCR assays

      Total RNA was isolated from cells or mouse mandible and maxilla tissues using miRNeasy Mini Kit. Reverse transcription and quantitative real-time PCR were carried out with miScript PCR system (Qiagen) according to the manufacturer’s protocol. All Ct numbers were below 35 cycles. PCR products were examined by melting curve analysis, and the sequences were confirmed. Fold changes were calculated using the 2–ΔΔCT method. The primers used for qPCR are listed in Table 1. The primers used to detect miR-23a/b were purchased from Qiagen.
      Table 1The sequence of the mouse qPCR and ChIP primers used for this study
      ForwardReverse
      Genes and qPCR primers
       B-actinGCCTTCCTTCTTGGGTATGACCACCAGACAGCACTGTG
       AmelogeninTACCACCTCATCCTGGAAGCGTGATGAGGCTGAAGGGTGT
       Pitx2CTGGAAGCCACTTTCCAGAGAAGCCATTCTTGCACAGCTC
       Hmgn2AAAACCAAGGTGAAGGACGATCTGTGCCTGGTCTGTTTTG
      ChIP primers
       pre-miR-23a-27a-24-2 (Pitx2)TCCTGCCCTAACCTGTCAGAAGCTAAGGACCCAACCGACT
       pre-miR-23a-27a-24-2 (con)GCCTCCCTGTTTGATGTCTCCAGCTGGTTCTGTCATGCTC.
       pre-miR-23b-27b-24-1 (Pitx2)GAGCTGAGACCTGCTCATCCGGTGACTGACTGTCCTGTGC
       pre-miR-23b-27b-24-1 (con)TGTGTGTGTGTGATGTTTAAGGACAGCTTTCTTTCTGTGTCAATGAT

      Imaging and microcomputed tomography

      Mouse heads of littermate WT and HMGN2−/− mice were dissected, fixed with 4% PFA overnight, and stored in 70% ethanol for imaging. Microcomputed tomography was conducted according to previous description (
      • Sun Z.
      • da Fontoura C.S.G.
      • Moreno M.
      • Holton N.E.
      • Sweat M.
      • Sweat Y.
      • et al.
      FoxO6 regulates Hippo signaling and growth of the craniofacial complex.
      ).

      ChIP assay

      ChIP assays were performed as previously described (
      • Sun Z.
      • Yu W.
      • Sanz Navarro M.
      • Sweat M.
      • Eliason S.
      • Sharp T.
      • et al.
      Sox2 and Lef-1 interact with Pitx2 to regulate incisor development and stem cell renewal.
      ) using the ChIP Assay Kit (Zymo Research). LS8 cells were crosslinked in 1% formaldehyde at room temperature for 7 min. Crosslinked cells were sonicated three times (6 s duration for each round, 25% of maximum amplitude) to shear the genomic DNA in to 200 to 1000 bp fragments. Then the DNA–protein complexes were immunoprecipitated with 5 μg Pitx2 Ab (Capra Science) or 5 μg rabbit IgG as control. Precipitated DNAs were subjected to PCR to evaluate the enrichment of Pitx2 binding.
      The triple ChIP experiments were performed initially as described previously; however, after the initial IP with the chromatin factor and IgG control, the complexes were washed with high salt buffer to remove the Ab and resuspended in buffer. A second Ab and control IgG was used to pull down the complex again, and the isolated complexes were washed extensively in high salt buffer, followed by a third IP and reverse crosslinked and processed. The primers used for PCR are listed in Table 1. All the PCR products were analyzed on a 1.5% agarose gel for the correct size and confirmed by sequencing.

      Co-IP assay

      Lef-1-Hmgn2, Dlx2-Hmgn2, and FoxJ1-Hmgn2 endogenous complexes were IPed from LS-8 cells. Lef-1 Ab (Cell Signalling), Dlx2 Ab (Affinity BioReagents, Inc) and FoxJ1 Ab (Millipore) using 2 ug of Ab to pull down endogenous Hmgn2 using magnetic IgG Dynabeads (Thermo Fisher Scientific), then were washed and eluted according to the manufacturer's recommendations, and subjected to Western blot analysis. In other experiments, approximately 24 h after cell transfection with β-catenin, HMGN2, and Lef-1 (2.5 μg), CHO cells were rinsed with 1 ml of PBS and then incubated with 1 ml ice-cold radioimmunopreipitation assay buffer for 15 min at 4 °C. Cells were harvested and disrupted by repeated aspiration through a 25-gauge needle attached to a 1 ml syringe. The lysates were then incubated on ice for 30 min. Cellular debris was pelleted by centrifugation at 10,000g for 10 min at 4 °C. An aliquot of lysate was saved for analysis as input control. Supernatant was transferred to a fresh 1.5 ml microfuge tube on ice and precleared using the mouse ExactaCruz F IP matrix (ExactaCruz F; Santa Cruz Biotechnology) for 30 min at 4 °C. Matrix was removed by brief centrifugation, and supernatant was transferred to a new tube. An IP Ab–IP matrix complex was prepared as per the manufacturer's instructions using primary anti–β-catenin Ab (Millipore). The IP Ab–IP matrix complex was incubated with the precleared cell lysate at 4 °C for 12 h. After incubation, the lysate was centrifuged to pellet the IP matrix. The matrix was washed two times with PBS and resuspended in 15 μl of double-distilled water and 3 μl 6× SDS loading dye. Samples were boiled for 5 min and resolved on a 10% polyacrylamide gel. Western blotting was used with anti-HMGN2 Ab and horseradish peroxidase–conjugated rabbit ExactaCruz F reagent to detect immunoprecipitated proteins.

      Statistical analysis

      All quantified results are presented as mean ± SEM and with an N value indicating the number of biological repeats. A two-tailed unpaired Student's t test and either one- or two-way ANOVA were used to determine statistical significance.

      Data availability

      All data are contained within the article.

      Supporting information

      This article contains supporting information.

      Conflict of interest

      The authors declare that they have no conflicts of interest with the contents of this article.

      Acknowledgments

      We thank members of the Amendt and Bustin laboratories for their expertise and helpful discussions. We thank the Institute for Biosciences and Technology, Houston, TX for generating the Hmgn2-null mice. This work was supported by funds from the University of Iowa Carver College of Medicine and the National Institutes of Health grants DE13941 and DE028527 .

      Author contributions

      B. H., M. B., and B. A. A. conceptualization; S. E., D. S., F. P., Z. S., Z. Z., X. L., M. S., and S. R. V. methodology; S. E. and B. A. A. formal analysis; S. E., D. S., F. P., Z. S., Z. Z., X. L., M. S., and S. R. V. validation; S. E., D. S., F. P., Z. S., Z. Z., X. L., M. S., and S. R. V. investigation; B. A. A. resources; B. H. and M. B. writing–review & editing; B. A. A. supervision; B. A. A. funding acquisition.

      References

        • Shirakawa H.
        • Herrera J.E.
        • Bustin M.
        • Postnikov Y.
        Targeting of high mobility group-14-17 proteins in chromatin is independent of DNA sequence.
        J. Biol. Chem. 2000; 275: 37937-37944
        • Murphy K.J.
        • Cutter A.R.
        • Fang H.
        • Postnikov Y.V.
        • Bustin M.
        • Hayes J.J.
        HMGN1 and 2 remodel core and linker histone tail domains within chromatin.
        Nucl. Acid Res. 2017; 45: 9917-9930
        • Garza-Manero S.
        • Sindi A.A.A.
        • Mohan G.
        • Rehbini O.
        • Jeantet V.H.M.
        • Bailo M.
        • et al.
        Maintenance of active chromatin states by HMGN2 is required for stem cell identity in a pluripotent stem cell model.
        Epigenetics Chromatin. 2019; 12: 73
        • Martínez de Paz A.
        • Ausió J.
        HMGNs: the enhancer charmers.
        Bioessays. 2016; 38: 226-231
        • He B.
        • Deng T.
        • Zhu I.
        • Furusawa T.
        • Zhang S.
        • Tang W.
        • et al.
        Binding of HMGN proteins to cell specific enhancers stabilizes cell identity.
        Nat. Commun. 2018; 9: 5240
        • Bustin M.
        Chromatin unfolding and activation by HMGN∗ chromosomal proteins.
        Trends. Biochem. Sci. 2001; 25: 431-437
        • Trieschmann L.
        • Postnikov Y.V.
        • Rickers A.
        • Bustin M.
        Modular structure of chromosomal proteins HMG-14 and HMG-17; definition of a transcriptional activation domain distinct from the nucleosomal binding domain.
        Mol. Cell. Biol. 1995; 15: 6663-6669
        • Catez F.
        • Yang H.
        • Tracey K.J.
        • Reeves R.
        • Misteli T.
        • Bustin M.
        Network of dynamic interactions between histone H1 and high-mobility-group proteins in chromatin.
        Mol. Cell. Biol. 2004; 24: 4321-4328
        • Phair R.D.
        • Mistell T.
        High mobility of proteins in the mammalian cell nucleus.
        Nature. 2000; 404: 604-609
        • Amen M.
        • Espinoza H.M.
        • Cox C.
        • Liang X.
        • Wang J.
        • Link T.M.
        • et al.
        Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/beta-catenin signaling.
        Nucl. Acids Res. 2008; 36: 462-476
        • Mohamed O.A.
        • Bustin M.
        • Clarke H.J.
        High-mobility group proteins 14 and 17 maintain the timing of early embryonic development in the mouse.
        Dev. Biol. 2001; 229: 237-249
        • Lehtonen S.
        • Olkkonen V.M.
        • Stapleton M.
        • Zerial M.
        • Lehtonen E.
        HMG-17, a chromosomal non-histone protein, shows developmental regulation during organogenesis.
        Int. J. Dev. Biol. 1998; 42: 775-782
        • Travis A.
        • Amsterdam A.
        • Belanger C.
        • Grosschedl R.
        LEF-1, a gene encoding a lymphoid-specific protein with an HMG domain, regulates T-cell receptor a enhancer function.
        Genes Dev. 1991; 5: 880-894
        • Amendt B.A.
        • Sutherland L.B.
        • Semina E.
        • Russo A.F.
        The molecular basis of rieger syndrome: analysis of Pitx2 homeodomain protein activities.
        J. Biol. Chem. 1998; 273: 20066-20072
        • Semina E.V.
        • Reiter R.
        • Leysens N.J.
        • Alward L.M.
        • Small K.W.
        • Datson N.A.
        • et al.
        Cloning and characterization of a novel bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger syndrome.
        Nat. Genet. 1996; 14: 392-399
        • Gage P.J.
        • Suh H.
        • Camper S.A.
        The bicoid-related Pitx gene family in development.
        Mamm. Genome. 1999; 10: 197-200
        • Lin C.R.
        • Kioussi C.
        • O'Connell S.
        • Briata P.
        • Szeto D.
        • Liu F.
        • et al.
        Pitx2 regulates lung asymmetry, cardiac positioning and pituitary and tooth morphogenesis.
        Nature. 1999; 401: 279-282
        • Lu M.
        • Pressman C.
        • Dyer R.
        • Johnson R.L.
        • Martin J.F.
        Function of Rieger syndrome gene in left-right asymmetry and craniofacial development.
        Nature. 1999; 401: 276-278
        • Wang J.
        • Saadi I.
        • Wang J.
        • Engel J.J.
        • Kaburas A.
        • Russo A.F.
        • et al.
        PIAS1 and PIASy differentially regulate PITX2 transcriptional activities.
        J. Biol. Chem. 2013; 288: 12580-12595
        • Pispa J.
        • Thesleff I.
        Mechanisms of ectodermal organogenesis.
        Dev. Biol. 2003; 262: 195-205
        • Tucker A.
        • Sharpe P.
        The cutting-edge of mammalian development; how the embryo makes teeth.
        Nat. Rev. Genet. 2004; 5: 499-508
        • Vadlamudi U.
        • Espinoza H.M.
        • Ganga M.
        • Martin D.M.
        • Liu X.
        • Engelhardt J.F.
        • et al.
        PITX2, β-catenin, and LEF-1 interact to synergistically regulate the LEF-1 promoter.
        J. Cell Sci. 2005; 118: 1129-1137
        • Amen M.
        • Liu X.
        • Vadlamudi U.
        • Elizondo G.
        • Diamond E.
        • Engelhardt J.F.
        • et al.
        PITX2 and β-catenin interactions regulate lef-1 isoform expression.
        Mol. Cell. Biol. 2007; 27: 7560-7573
        • Sun Z.
        • Yu W.
        • Sanz Navarro M.
        • Sweat M.
        • Eliason S.
        • Sharp T.
        • et al.
        Sox2 and Lef-1 interact with Pitx2 to regulate incisor development and stem cell renewal.
        Development. 2016; 143: 4115-4126
        • Sweat Y.Y.
        • Sweat M.
        • Yu W.
        • Sanz-Navarro M.
        • Zhang L.
        • Sun Z.
        • et al.
        Sox2 controls periderm and rugae development to inhibit oral adhesions.
        J. Dent. Res. 2020; 99: 1397-1405
        • van Genderen C.
        • Okamura R.M.
        • Farinas I.
        • Quo R.-G.
        • Parslow T.G.
        • Bruhn L.
        • et al.
        Development of several organs that require inductive epithelial-mesenchymal interactions is impared in LEF-1-deficient mice.
        Genes Dev. 1994; 8: 2691-2703
        • Sasaki T.
        • Ito Y.
        • Xu X.
        • Han J.
        • Bringas J.,P.
        • Maeda T.
        • et al.
        LEF1 is a critical epithelial survival factor during tooth morphogenesis.
        Dev. Biol. 2005; 278: 130-143
        • Zhao Y.
        • Ransom J.F.
        • Li A.
        • Vedantham V.
        • von Drehle M.
        • Muth A.N.
        • et al.
        Dysregulation of cardiogenesis, cardiac conduction, and cell cycle in mice lacking miRNA-1-2.
        Cell. 2007; 129: 303-317
        • Ucar A.
        • Vafaizadeh V.
        • Jarry H.
        • Fiedler J.
        • Klemmt P.A.B.
        • Thum T.
        • et al.
        miR-212 and miR-132 are required for epithelial stromal interactions necessary for mouse mammary gland development.
        Nat. Genet. 2010; 42: 1101-1108
        • Grimson A.
        • Farh K.K.
        • Johnston W.K.
        • Garrett-Engele P.
        • Lim L.P.
        • Bartel D.P.
        MicroRNA targeting specificity in mammals: determinants beyond seed pairing.
        Mol. Cell. 2007; 27: 91-105
        • Cao H.
        • Wang J.
        • Li X.
        • Florez S.
        • Huang Z.
        • Venugopalan S.R.
        • et al.
        MicroRNAs play a critical role in tooth development.
        J. Dent. Res. 2010; 89: 779-784
        • Shen Y.
        • Li Y.
        • Ye F.
        • Wang F.
        • Wan X.
        • Lu W.
        • et al.
        Identification of miR-23a as a novel microRNA normalizer for relative quantification in human uterine cervical tissues.
        Exp. Mol. Med. 2011; 43: 358-366
        • Chen Q.
        • Xu J.
        • Li L.
        • Li H.
        • Mao S.
        • Zhang F.
        • et al.
        MicroRNA-23a/b and microRNA-27a/b suppress Apaf-1 protein and alleviate hypoxia-induced neuronal apoptosis.
        Cell Death Dis. 2014; 5: e1132
        • Gao P.
        • Tchernyshyov I.
        • Chang T.C.
        • Lee Y.S.
        • Kita K.
        • Ochi T.
        • et al.
        c-Myc suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism.
        Nature. 2009; 458: 762-765
        • Viswanathan V.
        • Damle S.
        • Zhang T.
        • Opdenaker L.
        • Modarai S.
        • Accerbi M.
        • et al.
        An miRNA expression signature for the human colonic stem cell niche distinguishes malignant from normal epithelia.
        Cancer Res. 2017; 77: 3778-3790
        • Li A.
        • Song T.
        • Wang F.
        • Liu D.
        • Fan Z.
        • Zhang C.
        • et al.
        MicroRNAome and expression profile of developing tooth germ in miniature pigs.
        PLoS One. 2012; 7e52256
        • Hu C.-D.
        • Chinenov Y.
        • Kerppola T.K.
        Visualization of interactions among bZIP and rel family proteins in living cells using bimolecular fluorescence complementation.
        Mol. Cell. 2002; 9: 789-798
        • Zhang Z.
        • Gutierrez D.
        • Li X.
        • Wang J.
        • Andrade K.
        • Amendt B.A.
        Homeodomain transcription factor Lhx6: a transcriptional repressor that interacts with PITX2 to regulate odontogenesis.
        J. Biol. Chem. 2013; 288: 2485-2500
        • Li X.
        • Venugopalan S.
        • Cao H.
        • Pinho F.
        • Paine M.L.
        • Snead M.L.
        • et al.
        A model for the molecular underpinnings of tooth defects in axenfeld-rieger syndrome.
        Hum. Mol. Genet. 2013; 23: 194-208
        • Cox C.J.
        • Espinoza H.M.
        • McWilliams B.
        • Chappell K.
        • Morton L.
        • Hjalt T.A.
        • et al.
        Differential regulation of gene expression by PITX2 isoforms.
        J. Biol. Chem. 2002; 277: 25001-25010
        • Diamond E.
        • Amen M.
        • Hu Q.
        • Espinoza H.M.
        • Amendt B.A.
        Functional interactions between Dlx2 and lymphoid enhancer factor regulate Msx2.
        Nucl. Acids Res. 2006; 34: 5951-5965
        • Green P.D.
        • Hjalt T.A.
        • Kirk D.E.
        • Sutherland L.B.
        • Thomas B.L.
        • Sharpe P.T.
        • et al.
        Antagonistic regulation of Dlx2 expression by PITX2 and Msx2: implications for tooth development.
        Gene Expr. 2001; 9: 265-281
        • Espinoza H.M.
        • Cox C.J.
        • Semina E.V.
        • Amendt B.A.
        A molecular basis for differential developmental anomalies in Axenfeld-Rieger syndrome.
        Hum. Mol. Genet. 2002; 11: 743-753
        • Venugopalan S.R.
        • Amen M.A.
        • Wang J.
        • Wong L.
        • Cavender A.C.
        • D'Souza R.N.
        • et al.
        Novel expression and transcriptional regulation of FoxJ1 during oro-facial morphogenesis.
        Hum. Mol. Genet. 2008; 17: 3643-3654
        • Wibmuller S.
        • Kosian T.
        • Wolf M.
        • Finzsch M.
        • Wegner M.
        The high-mobility-group domain of Sox proteins interacts with DNA-binding domains of many transcription factors.
        Nucl. Acids Res. 2006; 34: 1735-1744
        • Deng T.
        • Zhu Z.
        • Zhang S.
        • Postnikov Y.
        • Huang D.
        • Horsch M.
        • et al.
        Functional compensation among HMGN variants modulates the DNase I hypersensitive sites at enhancers.
        Genome Res. 2015; 25: 1295-1308
        • Wang Y.
        • Li X.
        • Hu H.
        H3K4me2 reliably defines transcription factor binding regions in different cells.
        Genomics. 2014; 103: 222-228
        • Zhao R.
        • Nakamura T.
        • Fu Y.
        • Lazar Z.
        • Spector D.L.
        Gene bookmarking accelerates the kinetics of post-mitotic transcriptional re-activation.
        Nat. Cell. Biol. 2011; 13: 1295-1304
        • Eliason S.
        • Sharp T.
        • Sweat M.
        • Sweat Y.Y.
        • Amendt B.A.
        Ectodermal organ development is regulated by a microRNA-26b-lef-1-Wnt signaling Axis.
        Front. Physiol. 2020; 11: 780
        • Biehs B.
        • Hu J.K.
        • Strauli N.B.
        • Sangiorgi E.
        • Jung H.
        • Heber R.P.
        • et al.
        BMI1 represses Ink4a/Arf and Hox genes to regulate stem cells in the rodent incisor.
        Nat. Cell Biol. 2013; 15: 846-852
        • Rochman M.
        • Postnikov Y.
        • Correll S.
        • Malicet C.
        • Wincovitch S.
        • Karpova T.S.
        • et al.
        The interaction of NSBP1/HMGN5 with nucleosomes in euchromatin counteracts linker histone-mediated chromatin compaction and modulates transcription.
        Mol. Cell. 2009; 35: 642-656
        • Rattner B.P.
        • Yusufzai T.
        • Kadonaga J.T.
        HMGN proteins act in opposition to ATP-dependent chromatin remodeling factors to restrict nucleosome mobility.
        Mol Cell. 2009; 34: 620-626
        • Fiorillo A.A.
        • Medler T.R.
        • Feeney Y.B.
        • Liu Y.
        • Tommerdahl K.L.
        • Clevenger C.V.
        HMGN2 inducibly binds a novel transactivation domain in nuclear PRLr to coordinate Stat5a-mediated transcription.
        Mol. Endocrinol. 2011; 25: 1550-1564
        • Furusawa T.
        • Lim J.-H.
        • Catez F.
        • Birger Y.
        • Mackem S.
        • Bustin M.
        Down-regulation of nucleosomal binding protein HMGN1 expression during embryogenesis modulates Sox9 expression in chondrocytes.
        Mol. Cell. Biol. 2006; 26: 592-604
        • Zhu X.
        • Gleiberman A.S.
        • Rosenfeld M.G.
        Molecular physiology of pituitary development: signaling and transcriptional networks.
        Physiol. Rev. 2007; 87: 933-963
        • Hock R.
        • Furusawa T.
        • Ueda T.
        • Bustin M.
        HMG chromosomal proteins in development and disease.
        Trends Cell Biol. 2007; 17: 72-79
        • Venugopalan S.R.
        • Li X.
        • Amen M.A.
        • Florez S.
        • Gutierrez D.
        • Cao H.
        • et al.
        Hierarchical interactions of homeodomain and forkhead transcription factors in regulating odontogenic gene expression.
        J. Biol. Chem. 2011; 286: 21372-21383
        • Lehtonen S.
        • Lehtonen E.
        HMG-17 is an early marker of inductive interactions in the developing mouse kidney.
        Differentiation. 2001; 67: 154-163
        • Bustin M.
        • Neihart N.K.
        Antibodies against chromosomal HMG proteins stain the cytoplasm of mammalian cells.
        Cell. 1979; 16: 181-189
        • Lim J.-H.
        • West K.L.
        • Rubinstein Y.
        • Bergel M.
        • Postnikov Y.V.
        • Bustin M.
        Chromosomal protein HMGN1 enhances the acetylation of lysine 14 in histone H3.
        EMBO J. 2005; 24: 3038-3048
        • Chen L.S.
        • Couwenhoven R.I.
        • Hsu D.
        • Luo W.
        • Snead M.L.
        Maintenance of amelogenin gene expression by transformed epithelial cells of mouse enamel organ.
        Arch. Oral Biol. 1992; 37: 771-778
        • Sun Z.
        • da Fontoura C.S.G.
        • Moreno M.
        • Holton N.E.
        • Sweat M.
        • Sweat Y.
        • et al.
        FoxO6 regulates Hippo signaling and growth of the craniofacial complex.
        PLoS Genet. 2018; 14e1007675