Advertisement

Histone deacetylase-10 liberates spermidine to support polyamine homeostasis and tumor cell growth

Open AccessPublished:August 18, 2022DOI:https://doi.org/10.1016/j.jbc.2022.102407
      Cytosolic histone deacetylase-10 (HDAC10) specifically deacetylates the modified polyamine N8-acetylspermidine (N8-AcSpd). Although intracellular concentrations of N8-AcSpd are low, extracellular sources can be abundant, particularly in the colonic lumen. Extracellular polyamines, including those from the diet and microbiota, can support tumor growth both locally and at distant sites. However, the contribution of N8-AcSpd in this context is unknown. We hypothesized that HDAC10, by converting N8- AcSpd to spermidine, may provide a source of this growth-supporting polyamine in circumstances of reduced polyamine biosynthesis, such as in polyamine-targeting anticancer therapies. Inhibitors of polyamine biosynthesis, including α-difluoromethylornithine (DFMO), inhibit tumor growth, but compensatory uptake of extracellular polyamines has limited their clinical success. Combining DFMO with inhibitors of polyamine uptake have improved the antitumor response. However, acetylated polyamines may use different transport machinery than the parent molecules. Here, we use CRISPR/Cas9-mediated HDAC10-knockout cell lines and HDAC10-specific inhibitors to investigate the contribution of HDAC10 in maintaining tumor cell proliferation. We demonstrate inhibition of cell growth by DFMO-associated polyamine depletion is successfully rescued by exogenous N8-AcSpd (at physiological concentrations), which is converted to spermidine and spermine, only in cell lines with HDAC10 activity. Furthermore, we show loss of HDAC10 prevents both restoration of polyamine levels and growth rescue, implicating HDAC10 in supporting polyamine-associated tumor growth. These data suggest the utility of HDAC10-specific inhibitors as an antitumor strategy that may have value in improving the response to polyamine-blocking therapies. Additionally, the cell-based assay developed in this study provides an inexpensive, high-throughput method of screening potentially selective HDAC10 inhibitors.

      Keywords

      Abbreviations:

      AG (aminoguanidine), DFMO (difluoromethylornithine), N1-AcSpd (N1-acetylspermidine), diAcSpd (N1,N8-diacetylspermidine), HDAC10 (histone deacetylase-10), N8-AcSpd (N8-acetylated spermidine), Spd (spermidine), TME (tumor microenvironment)
      A class IIb cytosolic HDAC, histone deacetylase-10 (HDAC10), functions as a polyamine deacetylase, with high specificity for acetylated polyamines, particularly N8-acetylated spermidine (N8-AcSpd), over histones and other lysine-containing peptides (
      • Hai Y.
      • Shinsky S.A.
      • Porter N.J.
      • Christianson D.W.
      Histone deacetylase 10 structure and molecular function as a polyamine deacetylase.
      ). Acetylation of polyamines generally serves to reduce their positive charge, facilitating membrane transport (
      • Seiler N.
      Functions of polyamine acetylation.
      ). Nuclear N8-acetylation of spermidine (Spd) is believed to facilitate its transport to the cytoplasm, where HDAC10 mediates its deacetylation back to spermidine (
      • Hai Y.
      • Shinsky S.A.
      • Porter N.J.
      • Christianson D.W.
      Histone deacetylase 10 structure and molecular function as a polyamine deacetylase.
      • Desiderio M.A.
      • Weibel M.
      • Mamont P.S.
      Spermidine nuclear acetylation in rat hepatocytes and in logarithmically growing rat hepatoma cells: Comparison with histone acetylation.
      ,
      • Blankenship J.
      Deacetylation of N8-acetylspermidine by subcellular fractions of rat tissue.
      ,
      • Blankenship J.
      • Walle T.
      Acetylation of spermidine and spermine by rat liver and kidney chromatin.
      ). HDAC10 has been shown to have roles in autophagy, differentiation, DNA repair, exocytosis, and chemoresistance (
      • Ridinger J.
      • Koeneke E.
      • Kolbinger F.R.
      • Koerholz K.
      • Mahboobi S.
      • Hellweg L.
      • et al.
      Dual role of HDAC10 in lysosomal exocytosis and DNA repair promotes neuroblastoma chemoresistance.
      ,
      • Oehme I.
      • Linke J.P.
      • Bock B.C.
      • Milde T.
      • Lodrini M.
      • Hartenstein B.
      • et al.
      Histone deacetylase 10 promotes autophagy-mediated cell survival.
      ,
      • Mudumba S.
      • Menezes A.
      • Fries D.
      • Blankenship J.
      Differentiation of PC12 cells induced by N8-acetylspermidine and by N8-acetylspermidine deacetylase inhibition.
      ,
      • Tao X.
      • Yan Y.
      • Lu L.
      • Chen B.
      HDAC10 expression is associated with DNA mismatch repair gene and is a predictor of good prognosis in colon carcinoma.
      ), as well as epigenetic regulation (
      • Cheng F.
      • Zheng B.
      • Wang J.
      • Zhao G.
      • Yao Z.
      • Niu Z.
      • et al.
      Histone deacetylase 10, a potential epigenetic target for therapy.
      ). However, none of these roles have been clearly linked to its function as a polyamine deacetylase.
      Polyamine homeostasis is dysregulated in nearly all cancer types, and targeting polyamine metabolism for cancer prevention and treatment has been a longstanding therapeutic strategy that has achieved some success (
      • Casero Jr., R.A.
      • Murray Stewart T.
      • Pegg A.E.
      Polyamine metabolism and cancer: Treatments, challenges and opportunities.
      ). Difluoromethylornithine (DFMO) is an irreversible inhibitor of ornithine decarboxylase, the first rate-limiting step in polyamine biosynthesis (Fig. 1). Approved for the treatment of African trypanosomiasis, DFMO has a proven safety record and is a promising chemopreventive agent (
      • Bassiri H.
      • Benavides A.
      • Haber M.
      • Gilmour S.K.
      • Norris M.D.
      • Hogarty M.D.
      Translational development of difluoromethylornithine (DFMO) for the treatment of neuroblastoma.
      ,
      • Gerner E.W.
      • Bruckheimer E.
      • Cohen A.
      Cancer pharmacoprevention: targeting polyamine metabolism to manage risk factors for colon cancer.
      ). However, compensatory mechanisms exist through which tumor cells respond to reduced intracellular polyamine biosynthesis by increasing import of polyamines from the extracellular environment. Extracellular polyamines, including those in the tumor microenvironment (TME), derive from sources including diet, metabolic products of the microbiota, and sloughed or damaged cells, particularly in the intestinal lumen (
      • Holbert C.E.
      • Cullen M.T.
      • Casero Jr., R.A.
      • Stewart T.M.
      Polyamines in cancer: Integrating organismal metabolism and antitumour immunity.
      ). N8-AcSpd is rarely detected to accumulate intracellularly but has been detected in extracellular fluids in association with certain pathological states (
      • Saiki S.
      • Sasazawa Y.
      • Fujimaki M.
      • Kamagata K.
      • Kaga N.
      • Taka H.
      • et al.
      A metabolic profile of polyamines in Parkinson disease: a promising biomarker.
      ,
      • Abela L.
      • Simmons L.
      • Steindl K.
      • Schmitt B.
      • Mastrangelo M.
      • Joset P.
      • et al.
      N(8)-acetylspermidine as a potential plasma biomarker for Snyder-Robinson syndrome identified by clinical metabolomics.
      ,
      • Sánchez-Alcoholado L.
      • Laborda-Illanes A.
      • Otero A.
      • Ordóñez R.
      • González-González A.
      • Plaza-Andrades I.
      • et al.
      Relationships of gut microbiota composition, short-chain fatty acids and polyamines with the pathological response to neoadjuvant radiochemotherapy in colorectal cancer patients.
      ,
      • Nayak A.
      • Liu C.
      • Mehta A.
      • Ko Y.A.
      • Tahhan A.S.
      • Dhindsa D.S.
      • et al.
      N8-Acetylspermidine: a polyamine biomarker in ischemic cardiomyopathy with reduced ejection fraction.
      ). Additionally, it is a metabolite of certain types of bacteria (
      • Yoshimoto S.
      • Mitsuyama E.
      • Yoshida K.
      • Odamaki T.
      • Xiao J.Z.
      Enriched metabolites that potentially promote age-associated diseases in subjects with an elderly-type gut microbiota.
      ). Although generally regarded as an excretory metabolite, we considered that N8-AcSpd, via HDAC10-mediated deacetylation to spermidine, may serve as a source of polyamines to proliferating cells with increased polyamine requirements, particularly in the context of polyamine-limiting anticancer therapies.
      Figure thumbnail gr1
      Figure 1Schematic of the role of HDAC10 in supporting mammalian polyamine metabolism. Diflouromethylornithine (DFMO) inhibits ornithine decarboxylase (ODC), limiting polyamine biosynthesis and stimulating polyamine uptake from the tumor microenvironment in support of proliferation. Cytoplasmic HDAC10 converts imported N8-AcSpd into spermidine (Spd), which can be converted to spermine (Spm) or catabolized to putrescine (Put) via acetylation on its N1 position followed by oxidation, thereby re-establishing polyamine homeostasis. HDAC10, histone deacetylase-10; N8-AcSpd, N8-acetylated spermidine.

      Results

      Knockout of HDAC10 increases intracellular N8-AcSpd concentrations

      CRISPR/Cas9-mediated knockout of HDAC10 in HCT116 cells was evidenced by Western blotting (Fig. S1) followed by Sanger sequencing to confirm biallelic generation of indels. HeLa cell clones lacking HDAC10 were previously reported (
      • Steimbach R.R.
      • Herbst-Gervasoni C.J.
      • Lechner S.
      • Stewart T.M.
      • Klinke G.
      • Ridinger J.
      • et al.
      Aza-SAHA derivatives are selective histone deacetylase 10 chemical probes that inhibit polyamine deacetylation and phenocopy HDAC10 knockout.
      ). Mass spectrometry analyses verified significantly increased levels of N8-AcSpd in both HDAC10-KO cell lines (Fig. 2). HCT116 cells had greater concentrations of this derivative in both WT and KO lines than did HeLa cells. Both cell lines also had significant increases in N1,N8-diacetylspermidine (diAcSpd), and the extent of this increase tended to correlate with reduction of N1-acetylspermidine (N1-AcSpd). No significant differences were detected in spermidine concentrations with HDAC10 knockout in either cell line. These results are consistent with those observed in a neuroblastoma cell line with HDAC10-targeting siRNA (
      • Steimbach R.R.
      • Herbst-Gervasoni C.J.
      • Lechner S.
      • Stewart T.M.
      • Klinke G.
      • Ridinger J.
      • et al.
      Aza-SAHA derivatives are selective histone deacetylase 10 chemical probes that inhibit polyamine deacetylation and phenocopy HDAC10 knockout.
      ) and confirm an association of N8-AcSpd with HDAC10 in cell lines derived from multiple tissues.
      Figure thumbnail gr2
      Figure 2HDAC10 knockout alters intracellular levels of acetylated Spd derivatives. Targeted metabolomics data of wildtype (WT) and CRISPR/Cas9-generated HDAC10 knockout (KO) HCT116 (top) and HeLa S3 (bottom) cells. Statistically significant differences in metabolite concentrations between KO vs. WT are indicated as ∗ p ≤ 0.05, ∗∗p ≤ 0.01, and ∗∗∗p ≤ 0.001. HDAC10, histone deacetylase-10.

      Extracellular N8-AcSpd can support growth under polyamine-limiting conditions

      Treatment of tumor cells with DFMO generally leads to a cytostatic response resulting from the depletion of intracellular polyamines. The import of extracellular polyamines can rescue this growth inhibition; however, whether N8-AcSpd maintains this ability was unknown.
      Cotreatment of HDAC10WT HCT116 cells with DFMO and N8-AcSpd, in the presence of aminoguanidine to inhibit extracellular amine oxidation (
      • Murray Stewart T.
      • Dunston T.T.
      • Woster P.M.
      • Casero Jr., R.A.
      Polyamine catabolism and oxidative damage.
      ), demonstrated that this metabolite could rescue growth, while no rescue occurred in HDAC10KO cells (Fig. 3A), suggesting a role for HDAC10 in allowing N8-AcSpd to re-enter the polyamine metabolic pathway in support of proliferation (Fig. 1). HDAC10 status had no effect on rescue by either N1-AcSpd or unmodified Spd, consistent with its high specificity for the N8 modification. These results are consistent with those obtained using HDAC10WT and HDAC10KO HeLa cells (Fig. 3B). Although providing monoacetylated spermidine rescued growth in WT cells regardless of which end of spermidine was modified, N1,N8-diAcSpd failed to support proliferation in the presence of DFMO (Fig. S2).
      Figure thumbnail gr3
      Figure 3HDAC10 is required for rescue of DFMO-mediated cell growth inhibition by N8-AcSpd. Inhibition of polyamine biosynthesis with DFMO causes growth inhibition that can be rescued by exogenous polyamines. HDAC10 WT and KO HCT116 (A) and HeLa (B) cells were cotreated for 96 h with 5 mM DFMO and increasing concentrations of the indicated polyamine, with 1 mM aminoguanidine to prevent extracellular polyamine oxidation by bovine serum amine oxidase. Growth rescue was measured as a function of CellTiter-Blue fluorescence and is presented relative to cells not treated with DFMO. Loss of HDAC10 prevented rescue by N8-AcSpd but had no effect on rescue by N1-AcSpd or unmodified Spd, consistent with the reported substrate specificity of purified protein. Statistically significant differences in rescue between WT and KO cells are as indicated by ∗p ≤ 0.05, ∗∗p ≤ 0.01, and ∗∗∗p ≤ 0.001. DFMO, diflouromethylornithine; HDAC10, histone deacetylase-10; KO, knockout; N8-AcSpd, N8-acetylated spermidine; WT, wildtype.
      Studies with recombinant HDAC10 also indicated deacetylase activity for N-acetylputrescine (N-AcPut) (
      • Hai Y.
      • Shinsky S.A.
      • Porter N.J.
      • Christianson D.W.
      Histone deacetylase 10 structure and molecular function as a polyamine deacetylase.
      ). However, substituting N-AcPut for N8-AcSpd in our growth assays provided rescue regardless of the presence of HDAC10 (Fig. S2), consistent with alternative pathways for N-AcPut metabolism beyond HDAC10. As with Spd, unmodified putrescine (Put) also rescued DFMO-induced growth inhibition in both WT and KO cell lines.

      HDAC10 is essential in re-establishing polyamine homeostasis via N8-AcSpd

      The growth rescue provided by N8-AcSpd in the presence of HDAC10 suggested its deacetylation into Spd, which can then enter the polyamine metabolic pathway to re-establish polyamine homeostasis (Fig. 1). We therefore analyzed intracellular polyamine concentrations following the combination treatments in HDAC10 WT and KO cell lines (Fig. 4). Treatment with DFMO similarly depleted Spd in all cell lines. In cell lines with WT HDAC10, treatment with N8-AcSpd led to a dose-dependent restoration of both Spd and spermine (Spm) levels, with very little accumulation of the acetylated metabolite below the highest dose level (50 μM). In contrast, N8-AcSpd markedly accumulated in HDAC10KO cells at all concentrations tested, and no significant conversion to Spd was evident, supporting HDAC10 as the sole enzyme responsible for the deacetylation of N8-AcSpd. These data indicate that HDAC10 is an essential component in the metabolism of N8-AcSpd into Spd, allowing its subsequent interconversion within the polyamine metabolic pathway to restore growth-promoting polyamine homeostasis.
      Figure thumbnail gr4
      Figure 4Extracellular N8-AcSpd functions as a source of polyamines for mammalian cells via HDAC10-mediated deacetylation. In HDAC10WT HCT116 (A) and HeLa (B) cells with DFMO-associated polyamine depletion, extracellular N8-AcSpd is rapidly converted to replenish SPD and SPM pools and rescue proliferation. In HDAC10KO cells, N8-AcSpd is accumulated without conversion to SPD, coincident with the continuation of growth inhibition. ∗ indicates statistical significance relative to DFMO-treated HDAC10WT cells; # indicates statistical significance of KO cells relative to the same treatment condition in WT cells. ∗ or # p ≤ 0.05, ∗∗ or ## p ≤ 0.01, ∗∗∗ or ### p ≤ 0.001, ∗∗∗∗ or #### p ≤ 0.0001. DFMO, diflouromethylornithine; HDAC10, histone deacetylase-10; KO, knockout; N8-AcSpd, N8-acetylated spermidine.

      Inhibition of HDAC10 activity suppresses colon cancer cell growth rescue by N8-AcSpd

      N8-AcSpd is a metabolite present in feces and the intestinal lumen (
      • Yoshimoto S.
      • Mitsuyama E.
      • Yoshida K.
      • Odamaki T.
      • Xiao J.Z.
      Enriched metabolites that potentially promote age-associated diseases in subjects with an elderly-type gut microbiota.
      ). We therefore extended our recent studies using HDAC10-selective inhibitors (
      • Steimbach R.R.
      • Herbst-Gervasoni C.J.
      • Lechner S.
      • Stewart T.M.
      • Klinke G.
      • Ridinger J.
      • et al.
      Aza-SAHA derivatives are selective histone deacetylase 10 chemical probes that inhibit polyamine deacetylation and phenocopy HDAC10 knockout.
      ) to determine if inhibiting deacetylase activity was sufficient to prevent polyamine restoration and growth rescue by N8-AcSpd in HCT116 colon cancer cells. DKFZ-728 and DKFZ-748 (Fig. 5A) are newly described aza-SAHA derivatives with high biochemical and cellular specificity for HDAC10 over other HDAC isozymes. Incorporating these HDAC10 inhibitors into our growth rescue assays indicated dose-dependent reductions in the ability of N8-AcSpd to allow proliferation in HCT116 cells (Fig. 5B). DKFZ-748 was more effective at preventing rescue than DKFZ-728, consistent with previous biochemical studies indicating greater inhibition of HDAC10 activity by DKFZ-748 (
      • Steimbach R.R.
      • Herbst-Gervasoni C.J.
      • Lechner S.
      • Stewart T.M.
      • Klinke G.
      • Ridinger J.
      • et al.
      Aza-SAHA derivatives are selective histone deacetylase 10 chemical probes that inhibit polyamine deacetylation and phenocopy HDAC10 knockout.
      ). Indeed, at doses of 5 and 10 μM DKFZ-748, the number of cells proliferating in the presence of N8-AcSpd did not significantly differ from those with genetic knockout of HDAC10, suggesting that inhibition of HDAC10 enzymatic activity phenocopies genetic knockout. The structurally related, negative control compound DKFZ-828, which does not have an inhibitory effect on HDAC10 activity, similarly had no inhibitory effect on the rescue of cell growth by N8-AcSpd (Fig. S3).
      Figure thumbnail gr5
      Figure 5HDAC10-selective inhibitors prevent rescue of DFMO-mediated cytostasis and restoration of polyamine homeostasis by N8-AcSpd. A, structures of DKFZ-728 and DKFZ-748 HDAC10 inhibitors. B, HDAC10 inhibitors dose-dependently blocked rescue of cell growth by N8-AcSpd. HCT116 WT cells were pretreated 24 h with concentrations of HDAC10 inhibitors DKFZ-728 or DKFZ-748 ranging from 0.1 to 10 μM, followed by 96-h cotreatments with 5 mM DFMO, HDAC10 inhibitor, 1 mM AG, and increasing concentrations of N8-AcSpd. Percent growth relative to untreated cells was determined using CellTiter Blue–based fluorescence. C, pharmacological HDAC inhibition was as effective as genetic knockout in preventing entry of N8-AcSpd into the polyamine metabolic pathway. Treatment with the polyamine transport inhibitor Trimer44NMe prevented rescue by N8-AcSpd. HCT116 cells were treated as for growth assays and polyamines were determined by HPLC. ∗ indicates significantly increased intracellular polyamine concentration (Spd or Spm; p ≤ 0.05) compared to that of cells treated with DFMO alone. DFMO, diflouromethylornithine; HDAC10, histone deacetylase-10; N8-AcSpd, N8-acetylated spermidine.

      Pharmacological HDAC10 inhibition prevents restoration of polyamine homeostasis by N8-AcSpd

      To confirm that the inability of N8-AcSpd to rescue DFMO-mediated growth suppression in the presence of HDAC10 inhibitors is due to continued polyamine depletion, we analyzed intracellular polyamine concentrations following treatment in HCT116 cells (Fig. 5C). Both DKFZ-728 and DKFZ-748 effectively prevented the conversion of N8-AcSpd into Spd, as seen by the intracellular accumulation of the acetylated metabolite, with little increase in Spd or Spm levels. Although DKFZ-748 was again slightly more effective than DKFZ-728, the results with both inhibitors were comparable to those of HDAC10KO cells, further confirming that pharmacologically inhibiting HDAC10 activity reproduces the phenotype observed with its genetic elimination in colorectal cancer cells and that HDAC10 is the sole enzyme responsible for deacetylating N8-AcSpd.
      Cells were also treated with Trimer44NMe, a polyamine transport inhibitor (PTI) often used in conjunction with DFMO in polyamine-blocking strategies (
      • Alexander E.T.
      • El Naggar O.
      • Fahey E.
      • Mariner K.
      • Donnelly J.
      • Wolfgang K.
      • et al.
      Harnessing the polyamine transport system to treat BRAF inhibitor-resistant melanoma.
      ,
      • Alexander E.T.
      • Mariner K.
      • Donnelly J.
      • Phanstiel O.
      • Gilmour S.K.
      Polyamine blocking therapy decreases survival of tumor-infiltrating immunosuppressive myeloid cells and enhances the antitumor efficacy of PD-1 blockade.
      ,
      • Gitto S.B.
      • Pandey V.
      • Oyer J.L.
      • Copik A.J.
      • Hogan F.C.
      • Phanstiel O.t.
      • et al.
      Difluoromethylornithine combined with a polyamine transport inhibitor is effective against gemcitabine resistant pancreatic cancer.
      ,
      • Muth A.
      • Madan M.
      • Archer J.J.
      • Ocampo N.
      • Rodriguez L.
      • Phanstiel O.
      Polyamine transport inhibitors: Design, synthesis, and combination therapies with difluoromethylornithine.
      ), to determine its ability to block the import of acetylated spermidine. In both HCT116 and HeLa cells, adding the PTI prevented the uptake of N8-AcSpd, as evidenced by the lack of its conversion to spermidine as well as the absence of N8-AcSpd accumulation in the presence of the HDAC10 inhibitor (Figs. 5C and S4). Furthermore, no rescue of DFMO-mediated growth arrest by N8-AcSpd was evident in the presence of the PTI, which tended to exacerbate the growth inhibitory effects. These results demonstrate that the polyamine-blocking strategy of combining DFMO and Trimer44NMe sufficiently blocks uptake of N8-AcSpd, in addition to the unmodified polyamines.

      Discussion

      Under normal conditions, N8-AcSpd exists at low levels in cells and tissues and is believed to be rapidly converted to spermidine by a cytosolic polyamine deacetylase that is now known to be HDAC10 (
      • Hai Y.
      • Shinsky S.A.
      • Porter N.J.
      • Christianson D.W.
      Histone deacetylase 10 structure and molecular function as a polyamine deacetylase.
      ,
      • Blankenship J.
      Deacetylation of N8-acetylspermidine by subcellular fractions of rat tissue.
      ,
      • Blankenship J.
      • Marchant P.E.
      Metabolism of N1-acetylspermidine and N8-acetylspermidine in rats.
      ). N8-AcSpd is, however, abundant in certain TMEs. Generally regarded as excretory metabolites, acetylated polyamines such as N8-AcSpd are normal components of urine and feces (
      • Yoshimoto S.
      • Mitsuyama E.
      • Yoshida K.
      • Odamaki T.
      • Xiao J.Z.
      Enriched metabolites that potentially promote age-associated diseases in subjects with an elderly-type gut microbiota.
      ,
      • Seiler N.
      Catabolism of polyamines.
      ,
      • Wallace H.M.
      • Mackarel A.J.
      Regulation of polyamine acetylation and efflux in human cancer cells.
      ,
      • Xie X.
      • Gillies R.J.
      • Gerner E.W.
      Characterization of a diamine exporter in Chinese hamster ovary cells and identification of specific polyamine substrates.
      ). As they have been found to be elevated in association with certain pathologies, they have also been proposed as potential biomarkers, particularly for cancer (
      • Nakajima T.
      • Katsumata K.
      • Kuwabara H.
      • Soya R.
      • Enomoto M.
      • Ishizaki T.
      • et al.
      Urinary polyamine biomarker panels with machine-learning differentiated colorectal cancers, benign disease, and healthy controls.
      ,
      • Udo R.
      • Katsumata K.
      • Kuwabara H.
      • Enomoto M.
      • Ishizaki T.
      • Sunamura M.
      • et al.
      Urinary charged metabolite profiling of colorectal cancer using capillary electrophoresis-mass spectrometry.
      ). Enrichment of intracellular N8-AcSpd has been reported in tumor tissue of colorectal cancer patients, while it was undetectable in adjacent normal tissue (
      • Löser C.
      • Fölsch U.R.
      • Paprotny C.
      • Creutzfeldt W.
      Polyamines in colorectal cancer. Evaluation of polyamine concentrations in the colon tissue, serum, and urine of 50 patients with colorectal cancer.
      ). Similarly, urinary concentrations of N8-AcSpd in colorectal cancer patients was significantly greater than in healthy volunteers but did not significantly differ from that of patients with benign gastrointestinal disease, most of which were chronic inflammatory conditions associated with malignant potential (
      • Löser C.
      • Fölsch U.R.
      • Paprotny C.
      • Creutzfeldt W.
      Polyamines in colorectal cancer. Evaluation of polyamine concentrations in the colon tissue, serum, and urine of 50 patients with colorectal cancer.
      ). Increased intracellular levels of N8-AcSpd have also been measured in colonic intestinal epithelial cells (IECs) taken from inflammatory bowel disease (IBD) patients at the most severely inflamed mucosal areas (
      • Weiss T.S.
      • Herfarth H.
      • Obermeier F.
      • Ouart J.
      • Vogl D.
      • Scholmerich J.
      • et al.
      Intracellular polyamine levels of intestinal epithelial cells in inflammatory bowel disease.
      ), suggesting increased uptake. Breakdown of the mucosal barrier during IBD pathogenesis allows increased exposure of IECs to microbiota and metabolites, including endogenous polyamines released by necrotic or damaged cells. As colonic epithelial cells must proliferate and migrate to repair the epithelial barrier, their requirement for polyamines is increased, likely stimulating both biosynthesis and uptake (
      • Rao J.N.
      • Xiao L.
      • Wang J.Y.
      Polyamines in gut epithelial renewal and barrier function.
      ). A recent study directly demonstrated that microbiota-derived polyamines can be incorporated into host colonocytes to accelerate epithelial renewal (
      • Nakamura A.
      • Kurihara S.
      • Takahashi D.
      • Ohashi W.
      • Nakamura Y.
      • Kimura S.
      • et al.
      Symbiotic polyamine metabolism regulates epithelial proliferation and macrophage differentiation in the colon.
      ).
      Our studies indicate the important potential that extracellular acetylated polyamines, specifically N8-AcSpd, may serve as a source of polyamines for rapidly proliferating cells with increased requirements for polyamines – a nearly ubiquitous characteristic of tumor cells. Age-related changes in the composition of the microbiota are especially apparent in elderly populations and are associated with chronic low levels of inflammation. A comparison of fecal metabolites in elderly patients found elevated levels of N8-AcSpd in a patient population with an “elderly” type gut microbiota versus those with an age-mismatched, “adult” type microbiota generally associated with a younger population (11.6 nmol/g feces v. 7.4 nmol/g feces, respectively) (
      • Yoshimoto S.
      • Mitsuyama E.
      • Yoshida K.
      • Odamaki T.
      • Xiao J.Z.
      Enriched metabolites that potentially promote age-associated diseases in subjects with an elderly-type gut microbiota.
      ). Notably, these authors also showed that treatment of HCT116 colon cancer cells with N8-AcSpd induced expression of pro-inflammatory cytokines and prevented oxaliplatin-mediated cytotoxicity. It is not currently known if a role exists for HDAC10 in these gene expression changes.
      N8-AcSpd has also been shown to increase with age in the rat kidney, alongside an increase in spermidine acetyltransferase activities (
      • Ferioli M.E.
      • Sessa A.
      • Tunici P.
      • Pinotti O.
      • Perin A.
      Aging and polyamine acetylation in rat kidney.
      ). As de novo polyamine biosynthesis decreases with age in many tissues (
      • Minois N.
      • Carmona-Gutierrez D.
      • Madeo F.
      Polyamines in aging and disease.
      ), it has been suggested that maintaining acetylated spermidine pools, including N8-AcSpd, might compensate by increasing polyamine interconversion (
      • Ferioli M.E.
      • Sessa A.
      • Tunici P.
      • Pinotti O.
      • Perin A.
      Aging and polyamine acetylation in rat kidney.
      ). In fact, HDAC10 is highly expressed in the kidney, as well as the spleen and liver (
      • Tong J.J.
      • Liu J.
      • Bertos N.R.
      • Yang X.J.
      Identification of HDAC10, a novel class II human histone deacetylase containing a leucine-rich domain.
      ). Similarly, analyses of plasma metabolites in the long-lived naked mole rat revealed elevated N8-AcSpd levels, compared to mice of similar developmental stage, in the absence of the age-related decline in spermidine observed in other mammals (
      • Viltard M.
      • Durand S.
      • Perez-Lanzon M.
      • Aprahamian F.
      • Lefevre D.
      • Leroy C.
      • et al.
      The metabolomic signature of extreme longevity: Naked mole rats versus mice.
      ).
      The role of HDAC10 in supporting malignancy appears to be context dependent and may relate to the availability of N8-AcSpd in the TME. Expression levels of HDAC10 in cancer patients are seen to correlate both favorably and unfavorably with patient prognosis, depending on tumor origin (
      • Uhlen M.
      • Zhang C.
      • Lee S.
      • Sjostedt E.
      • Fagerberg L.
      • Bidkhori G.
      • et al.
      A pathology atlas of the human cancer transcriptome.
      ). Interestingly, Kaplan-Meier curves available at the Human Protein Atlas (proteinatlas.org) (
      • Uhlen M.
      • Zhang C.
      • Lee S.
      • Sjostedt E.
      • Fagerberg L.
      • Bidkhori G.
      • et al.
      A pathology atlas of the human cancer transcriptome.
      ) demonstrate that cancers in which high HDAC10 expression is associated with poor prognosis include those that are associated with TMEs enriched in excretory products, including renal cancer and colon adenocarcinoma. A recent analysis of TCGA data reported HDAC10 copy number gains as a risk factor for colorectal and pancreatic cancers (
      • Zhang T.
      • Wang B.
      • Gu B.
      • Su F.
      • Xiang L.
      • Liu L.
      • et al.
      Genetic and molecular characterization revealed the prognosis efficiency of histone acetylation in pan-digestive cancers.
      ). A study of colon cancer patients in China reported constitutively elevated expression of HDAC10 protein in tumor tissues compared to paired adjacent tissue in the majority of patients (
      • Tao X.
      • Yan Y.
      • Lu L.
      • Chen B.
      HDAC10 expression is associated with DNA mismatch repair gene and is a predictor of good prognosis in colon carcinoma.
      ), with the greatest difference observed in cytoplasmic HDAC10. Interestingly, while the expression level of HDAC10 in the tumor samples failed to correlate with clinicopathological factors, HDAC10 expression in the adjacent normal tissue positively correlated with the presence of lymph node and/or distant metastases. Further, while high cytoplasmic expression of HDAC10 in these tumors was predictive of good prognosis, high cytoplasmic expression in normal adjacent tissues predicted poor prognosis, and high nuclear HDAC10 expression in adjacent normal tissues correlated with improved survival (
      • Tao X.
      • Yan Y.
      • Lu L.
      • Chen B.
      HDAC10 expression is associated with DNA mismatch repair gene and is a predictor of good prognosis in colon carcinoma.
      ). Similarly, in lung cancer cells, HDAC10 was observed to localize in the cytoplasm, while its detection was predominantly nuclear in adjacent normal cells (
      • Yang Y.
      • Huang Y.
      • Wang Z.
      • Wang H.T.
      • Duan B.
      • Ye D.
      • et al.
      HDAC10 promotes lung cancer proliferation via AKT phosphorylation.
      ). These data suggest the importance of subcellular HDAC10 localization, which hints at the catalytic mechanism of action based on substrate availability, as N8-AcSpd deacetylation occurs in the cytoplasm. Conversely, nuclear localization of HDAC10 may be associated with its potential histone deacetylase activity (
      • Hai Y.
      • Shinsky S.A.
      • Porter N.J.
      • Christianson D.W.
      Histone deacetylase 10 structure and molecular function as a polyamine deacetylase.
      ,
      • Cheng F.
      • Zheng B.
      • Wang J.
      • Zhao G.
      • Yao Z.
      • Niu Z.
      • et al.
      Histone deacetylase 10, a potential epigenetic target for therapy.
      ).
      Purified HDAC10 protein has been shown to deacetylate N1,N8-diAcSpd (
      • Hai Y.
      • Shinsky S.A.
      • Porter N.J.
      • Christianson D.W.
      Histone deacetylase 10 structure and molecular function as a polyamine deacetylase.
      ), and our results showing increased levels of this metabolite in HDAC10-KO cells provide evidence of this reaction in situ. The increased abundance of N1,N8-diAcSpd in cells lacking HDAC10 appeared to correlate with decreases in the pools of N1-AcSpd, suggesting that HDAC10-mediated deacetylation of diAcSpd may be an alternative source of N1-AcSpd, in addition to the N1-acetylation of spermidine by SSAT. However, diAcSpd failed to rescue DFMO-mediated growth inhibition even in cells with WT HDAC10, suggesting two possibilities: 1) N1,N8-diAcSpd is not metabolized into a growth-supporting polyamine moiety; or 2) it is not transported into the cell, as suggested by competition studies with tritiated spermidine (
      • Porter C.W.
      • Cavanaugh Jr., P.F.
      • Stolowich N.
      • Ganis B.
      • Kelly E.
      • Bergeron R.J.
      Biological properties of N4- and N1,N8-spermidine derivatives in cultured L1210 leukemia cells.
      ). As our studies and others have indicated that N1-AcSpd can rescue DFMO-mediated growth arrest (
      • Mamont P.S.
      • Seiler N.
      • Siat M.
      • Joder-Ohlenbusch A.M.
      • Knodgen B.
      Metabolism of acetyl derivatives of polyamines in cultured polyamine-deficient rat hepatoma cells.
      ), the latter is most likely. Arylamine N-acetyltransferase (NAT2) was recently reported to acetylate N1-AcSpd at the N8 position in colon cancer cells, producing N1,N8-diAcSpd (
      • Conway L.P.
      • Rendo V.
      • Correia M.S.P.
      • Bergdahl I.A.
      • Sjöblom T.
      • Globisch D.
      Unexpected acetylation of endogenous aliphatic amines by arylamine N-acetyltransferase NAT2.
      ). Enzymatic assays indicated that NAT2 can also acetylate N8-AcSpd to produce the diacetylated molecule. Thus, the increase in diAcSpd might be secondary to the increased abundance of N8-AcSpd in the absence of HDAC10. Regardless, extracellular N1,N8-diAcSpd in the TME appears to be a metabolic end product incapable of supporting tumor cell growth.
      A main limitation of anticancer strategies targeting polyamine biosynthesis, particularly the use of DFMO, is the compensatory increase in polyamine uptake from the extracellular environment in order to maintain homeostasis (
      • Casero Jr., R.A.
      • Murray Stewart T.
      • Pegg A.E.
      Polyamine metabolism and cancer: Treatments, challenges and opportunities.
      ). Blocking this restoration of homeostasis is the goal of polyamine-blocking therapies, which incorporate the simultaneous inhibition of biosynthesis and transport (
      • Alexander E.T.
      • Mariner K.
      • Donnelly J.
      • Phanstiel O.
      • Gilmour S.K.
      Polyamine blocking therapy decreases survival of tumor-infiltrating immunosuppressive myeloid cells and enhances the antitumor efficacy of PD-1 blockade.
      ,
      • Muth A.
      • Madan M.
      • Archer J.J.
      • Ocampo N.
      • Rodriguez L.
      • Phanstiel O.
      Polyamine transport inhibitors: Design, synthesis, and combination therapies with difluoromethylornithine.
      ,
      • Hayes C.S.
      • Shicora A.C.
      • Keough M.P.
      • Snook A.E.
      • Burns M.R.
      • Gilmour S.K.
      Polyamine-blocking therapy reverses immunosuppression in the tumor microenvironment.
      ,
      • Weeks R.S.
      • Vanderwerf S.M.
      • Carlson C.L.
      • Burns M.R.
      • O'Day C.L.
      • Cai F.
      • et al.
      Novel lysine-spermine conjugate inhibits polyamine transport and inhibits cell growth when given with DFMO.
      ,
      • Burns M.R.
      • Graminski G.F.
      • Weeks R.S.
      • Chen Y.
      • O'Brien T.G.
      Lipophilic lysine-spermine conjugates are potent polyamine transport inhibitors for use in combination with a polyamine biosynthesis inhibitor.
      ). Several studies have indicated this to be a promising strategy, with effects on tumor cells as well as tumor-associated immune cells (
      • Holbert C.E.
      • Cullen M.T.
      • Casero Jr., R.A.
      • Stewart T.M.
      Polyamines in cancer: Integrating organismal metabolism and antitumour immunity.
      ,
      • Chin A.
      • Bieberich C.J.
      • Stewart T.M.
      • Casero R.A.
      Polyamine depletion strategies in cancer: remodeling the tumor immune microenvironment to enhance anti-tumor responses.
      ). However, mammalian polyamine transport is complex, and its mechanisms have not been fully elucidated. It is possible that N8-AcSpd, with its reduced charge, may not be a substrate for the same polyamine transporter that imports spermidine and spermine in mammalian cells. The commonly used PTI Trimer44NMe effectively blocked growth rescue and restoration of polyamine homeostasis by N8-AcSpd in our studies, suggesting that it also blocks transport of acetylated spermidine molecules. However, as the complexities of the polyamine transport system are still being elucidated, we emphasize that this finding should not be broadened to include all PTIs or all cell types as certain cell types appear to express multiple polyamine transporters with different substrate affinities (
      • Muth A.
      • Madan M.
      • Archer J.J.
      • Ocampo N.
      • Rodriguez L.
      • Phanstiel O.
      Polyamine transport inhibitors: Design, synthesis, and combination therapies with difluoromethylornithine.
      ,
      • Weeks R.S.
      • Vanderwerf S.M.
      • Carlson C.L.
      • Burns M.R.
      • O'Day C.L.
      • Cai F.
      • et al.
      Novel lysine-spermine conjugate inhibits polyamine transport and inhibits cell growth when given with DFMO.
      ). On this basis, we speculate that specific inhibition of HDAC10 may improve the efficacy of polyamine-blocking therapy by blocking an alternative source of spermidine in certain TMEs.
      In conclusion, our studies indicate an essential role for HDAC10 in the conversion of N8-AcSpd to spermidine. To our knowledge, this is the first demonstration that N8-AcSpd can serve to re-establish polyamine homeostasis in colorectal cancer cells exposed to polyamine-limiting conditions. Our data indicate HDAC10-mediated deacetylation of exogenous polyamines as an alternative source of tumor-supporting polyamines capable of bypassing polyamine-limiting therapies, such as DFMO, emphasizing the need to consider this pathway in the design of polyamine-blocking strategies and suggesting that HDAC10-specific inhibitors may be a beneficial addition to such strategies in certain contexts. Additionally, our cell-based growth rescue assay provides an inexpensive method for future screening of potential HDAC10 inhibitors.

      Experimental procedures

      Cell culture and reagents

      HCT116 (CCL-247) and HeLa S3 (CCL-2.2) cells were obtained from ATCC. HCT116 cells were grown in McCoy’s 5A medium with 10% fetal bovine serum (Gemini Bio Products) and penicillin/streptomycin solution (Corning). HeLa S3 cells were grown in MEM-alpha (Corning) with 10% fetal bovine serum, sodium pyruvate, and penicillin/streptomycin solution (Corning). Cell lines were maintained in a humidified atmosphere at 37°C, 5% CO2 and were routinely screened for mycoplasma infection using MycoAlert (Lonza).
      Aminoguanidine (AG; 1 mM) was used in all studies including the addition of exogenous polyamines to limit extracellular polyamine oxidation by bovine serum amine oxidase (
      • Murray Stewart T.
      • Dunston T.T.
      • Woster P.M.
      • Casero Jr., R.A.
      Polyamine catabolism and oxidative damage.
      ). DFMO was provided by Dr Patrick Woster at the Medical University of South Carolina. AG, N8-AcSpd, N1-AcSpd, N-AcPut, Put, Spd, and Spm were purchased from Sigma Chemical Co. N1,N8-diAcSpd was purchased from Cayman Chemical Co. The polyamine transport inhibitor Trimer44NMe was provided by Dr Otto Phanstiel (University of Central Florida).

      CRISPR-Cas9-mediated HDAC10 knockout

      Oligonucleotides targeting the HDAC10 gene were synthesized, annealed, and ligated into the single guide RNA scaffold of the LentiCRISPRv2-Blast vector (AddGene) via the BsmBI sites, according to methods previously described (
      • Sanjana N.E.
      • Shalem O.
      • Zhang F.
      Improved vectors and genome-wide libraries for CRISPR screening.
      ). Three different oligo pairs were chosen for construct synthesis targeting the following sequences in exon 2 (sgRNA one and 2) or 11 (sgRNA3) of HDAC10:
      sgRNA1 AGTGCGAGATCGAGCGTCCTG
      sgRNA2 GGATCGCCTGCGGCAGCGC
      sgRNA3 GCATGACAGTACAGACGCTGC
      Successful construct generation was verified by Sanger sequencing of the sgRNA region. Transfections of HCT116 and HeLa cells were performed using Lipofectamine 3000 (Invitrogen) followed by single-cell isolation through limiting dilution arrays and selection in growth media containing 10 μg/ml blasticidin. Lysates of individual CRISPR-Cas9-edited clones were prepared in 4% SDS for HDAC10 knockout screening by Western Blot. Proteins (30 μg/lane) were separated on 4 to 12% Bolt Bis-Tris polyacrylamide gels in MES running buffer (Invitrogen) and transferred onto Immun-blot PVDF membranes (Bio-Rad). Primary antibodies to HDAC10 (1:1000; Sigma #H3413) and PCNA (1:4000; Calbiochem #NA03) were incubated overnight at 4°C with rocking; IR-dye conjugated secondary antibodies (1:10,000; LI-COR #926–32211 and 1:20,000; ThermoFisher Scientific #A-21057) allowed detection using a LI-COR Odyssey imager with ImageStudioLite analysis software (LI-COR). Biallelic knockout through indel generation was confirmed in each cell line following PCR amplification of genomic DNA (extracted using Zymo Quick gDNA Micropreps) with primers flanking the guide RNA target of the HDAC10 gene. PCR products were TOPO-TA cloned into the pCR4 vector for sequencing according to the manufacturer’s protocol (Invitrogen). All primers were synthesized by IDT, and Sanger sequencing was performed by the Genetic Resources Core Facility of the Johns Hopkins University School of Medicine. Individual clones with successful HDAC10 knockout via each of the three targeted sequences were analyzed for variations in polyamine concentrations by HPLC. As no significant difference was detected, cell lines with biallelic indels in HDAC10 exon 2 (targeted by sgRNA1 above) were chosen for subsequent experiments.

      Targeted metabolomics of acetylated spermidine

      A targeted metabolomics approach was used to quantify acetylated polyamines in the HDAC10-knockout cells via UPLC-MS/MS. Each cell line was plated in triplicate 15-cm culture dishes at a density of 4 million cells/dish. After approximately 48 h, cells were collected, centrifuged, and resuspended in PBS with an aliquot taken for cell counts using trypan blue exclusion and a hemacytometer. Two cell pellets containing at least 10 million and 5 million cells each were produced from each culture dish and quick-frozen in a dry ice/ethanol bath for storage at -80°C. Extraction and quantification of acetylated spermidine was performed by UPLC-MS/MS as previously described (
      • Steimbach R.R.
      • Herbst-Gervasoni C.J.
      • Lechner S.
      • Stewart T.M.
      • Klinke G.
      • Ridinger J.
      • et al.
      Aza-SAHA derivatives are selective histone deacetylase 10 chemical probes that inhibit polyamine deacetylation and phenocopy HDAC10 knockout.
      ).

      Cell proliferation studies

      Cells were seeded in triplicate at 1000 cells/well of 96-well plates and allowed to attached overnight. Medium was aspirated and replaced with 100 μl of fresh medium containing 1 mM AG, 5 mM DFMO, and increasing concentrations of N8-AcSpd, Spd, N1-AcSpd, N-AcPut, Put, or N1,N8-diAcSpd. After incubation for 96 h, 20 μl of CellTiter-Blue reagent (Promega) was added and cells were incubated for an additional 2 h. Fluorescence was measured (560Ex/590Em) on a SpectraMax M5 (Molecular Devices). In experiments using HDAC10 inhibitors, cells were pretreated 24 h with the inhibitor (added approximately 4 h post seeding), after which the medium was replaced with that containing inhibitor, DFMO, and N8-AcSpd for an additional 96-h incubation.

      HPLC analysis of polyamine concentrations

      Cells were seeded at 0.6 x 105 cells per T-25 flask and allowed to attached overnight. Media was aspirated and replaced with that containing 1 mM AG, 5 mM DFMO, and N8-AcSpd at final concentrations of 5, 10, or 50 μM, followed by incubation for 96 h. Cell lysates were collected and acid-precipitated, and supernatants were used for precolumn derivatization of polyamines with Dansyl chloride (Sigma) in the presence of diaminoheptane as an internal standard. For experiments including HDAC10 inhibitors, cells were seeded as above and allowed to adhere to the flask approximately 4 h, at which time the inhibitor was added. After a 24-h pretreatment, the media was aspirated and refreshed with that containing inhibitor, DFMO, AG, and N8-AcSpd, for an additional 96-h incubation. Polyamines were quantified by HPLC as previously described (
      • Kabra P.M.
      • Lee H.K.
      • Lubich W.P.
      • Marton L.J.
      Solid-phase extraction and determination of dansyl derivatives of unconjugated and acetylated polyamines by reversed-phase liquid chromatography: Improved separation systems for polyamines in cerebrospinal fluid, urine and tissue.
      ) and are presented relative to total cellular protein in the lysate, as determined based on the method of Bradford (Bio-Rad Protein Assay), with interpolation on a bovine serum albumin standard curve.

      Statistical analyses

      All statistically significant results were determined using GraphPad Prism (v. 9.3.1). Results are indicative of at least two independent biological replicates with at least duplicate determinations of each. Significant differences in polyamine concentrations between HDAC10 KO vs. WT were determined by an unpaired t test with Welch’s correction. Significant differences in cell growth rescue were calculated between WT and KO cells at each concentration by two-way ANOVA with the Sidak test for multiple comparisons. Differences in individual polyamine concentrations following rescue were determined by two-way ANOVA with Fisher’s LSD test. Designations for significance in all cases are the following: ∗ p-value ≤ 0.05, ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.001.

      Data availability

      All data are contained within the manuscript.

      Supporting information

      This article contains supporting information.

      Conflict of interest

      Work in the Casero and Stewart laboratory is supported, in part, by a research contract from Panbela Therapeutics, Inc.

      Acknowledgments

      DFMO was kindly provided by Dr Patrick Woster at the Medical University of South Carolina, and Trimer44NMe was a gift from Dr Otto Phanstiel, IV at the University of Central Florida. We thank Dr David Christianson at the University of Pennsylvania for initially spawning our interest in HDAC10-mediated polyamine deacetylation.

      Author contributions

      T. M. S. and A. K. M. conceptualization; T. M. S., J. R. F., G. K., G. P., and R. A. C. methodology; T. M. S. validation; T. M. S. and R. R. S. formal analysis; T. M. S., J. R. F., G. K., G. P., and R. R. S. investigation; T. M. S. writing – original draft; T. M. S. and R. R. S. visualization; C. E. H., G. K., G. P., R. R. S., A. K. M., and R. A. C. writing – review and editing; A. K. M. and R. A. C. resources; A. K. M. and R. A. C. supervision; R. A. C. funding acquisition.

      Funding and additional information

      Work in the Casero and Stewart laboratory is supported by grants from the US National Institutes of Health, United States ( CA204345 and CA235863 ), the Samuel Waxman Cancer Research Foundation, United States , the University of Pennsylvania Orphan Disease Center, United States Million Dollar Bike Ride (MDBR-20–135-SRS), the Chan Zuckerberg Initiative, and a research contract from Panbela Therapeutics, Inc. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

      Supporting information

      References

        • Hai Y.
        • Shinsky S.A.
        • Porter N.J.
        • Christianson D.W.
        Histone deacetylase 10 structure and molecular function as a polyamine deacetylase.
        Nat. Commun. 2017; 8: 15368
        • Seiler N.
        Functions of polyamine acetylation.
        Can J. Physiol. Pharmacol. 1987; 65: 2024-2035
        • Desiderio M.A.
        • Weibel M.
        • Mamont P.S.
        Spermidine nuclear acetylation in rat hepatocytes and in logarithmically growing rat hepatoma cells: Comparison with histone acetylation.
        Exp. Cell Res. 1992; 202: 501-506
        • Blankenship J.
        Deacetylation of N8-acetylspermidine by subcellular fractions of rat tissue.
        Arch. Biochem. Biophys. 1978; 189: 20-27
        • Blankenship J.
        • Walle T.
        Acetylation of spermidine and spermine by rat liver and kidney chromatin.
        Arch. Biochem. Biophys. 1977; 179: 235-242
        • Ridinger J.
        • Koeneke E.
        • Kolbinger F.R.
        • Koerholz K.
        • Mahboobi S.
        • Hellweg L.
        • et al.
        Dual role of HDAC10 in lysosomal exocytosis and DNA repair promotes neuroblastoma chemoresistance.
        Sci. Rep. 2018; 8: 10039
        • Oehme I.
        • Linke J.P.
        • Bock B.C.
        • Milde T.
        • Lodrini M.
        • Hartenstein B.
        • et al.
        Histone deacetylase 10 promotes autophagy-mediated cell survival.
        Proc. Natl. Acad. Sci. U S A. 2013; 110: E2592-E2601
        • Mudumba S.
        • Menezes A.
        • Fries D.
        • Blankenship J.
        Differentiation of PC12 cells induced by N8-acetylspermidine and by N8-acetylspermidine deacetylase inhibition.
        Biochem. Pharmacol. 2002; 63: 2011-2018
        • Tao X.
        • Yan Y.
        • Lu L.
        • Chen B.
        HDAC10 expression is associated with DNA mismatch repair gene and is a predictor of good prognosis in colon carcinoma.
        Oncol. Lett. 2017; 14: 4923-4929
        • Cheng F.
        • Zheng B.
        • Wang J.
        • Zhao G.
        • Yao Z.
        • Niu Z.
        • et al.
        Histone deacetylase 10, a potential epigenetic target for therapy.
        Biosci. Rep. 2021; 41https://doi.org/10.1042/BSR20210462
        • Casero Jr., R.A.
        • Murray Stewart T.
        • Pegg A.E.
        Polyamine metabolism and cancer: Treatments, challenges and opportunities.
        Nat. Rev. Cancer. 2018; 18: 681-695
        • Bassiri H.
        • Benavides A.
        • Haber M.
        • Gilmour S.K.
        • Norris M.D.
        • Hogarty M.D.
        Translational development of difluoromethylornithine (DFMO) for the treatment of neuroblastoma.
        Transl Pediatr. 2015; 4: 226-238
        • Gerner E.W.
        • Bruckheimer E.
        • Cohen A.
        Cancer pharmacoprevention: targeting polyamine metabolism to manage risk factors for colon cancer.
        J. Biol. Chem. 2018; 293: 18770-18778
        • Holbert C.E.
        • Cullen M.T.
        • Casero Jr., R.A.
        • Stewart T.M.
        Polyamines in cancer: Integrating organismal metabolism and antitumour immunity.
        Nat. Rev. Cancer. 2022; 22: 467-480
        • Saiki S.
        • Sasazawa Y.
        • Fujimaki M.
        • Kamagata K.
        • Kaga N.
        • Taka H.
        • et al.
        A metabolic profile of polyamines in Parkinson disease: a promising biomarker.
        Ann. Neurol. 2019; 86: 251-263
        • Abela L.
        • Simmons L.
        • Steindl K.
        • Schmitt B.
        • Mastrangelo M.
        • Joset P.
        • et al.
        N(8)-acetylspermidine as a potential plasma biomarker for Snyder-Robinson syndrome identified by clinical metabolomics.
        J. Inherit. Metab. Dis. 2016; 39: 131-137
        • Sánchez-Alcoholado L.
        • Laborda-Illanes A.
        • Otero A.
        • Ordóñez R.
        • González-González A.
        • Plaza-Andrades I.
        • et al.
        Relationships of gut microbiota composition, short-chain fatty acids and polyamines with the pathological response to neoadjuvant radiochemotherapy in colorectal cancer patients.
        Int. J. Mol. Sci. 2021; 22https://doi.org/10.3390/ijms22179549
        • Nayak A.
        • Liu C.
        • Mehta A.
        • Ko Y.A.
        • Tahhan A.S.
        • Dhindsa D.S.
        • et al.
        N8-Acetylspermidine: a polyamine biomarker in ischemic cardiomyopathy with reduced ejection fraction.
        J. Am. Heart Assoc. 2020; 9: e016055
        • Yoshimoto S.
        • Mitsuyama E.
        • Yoshida K.
        • Odamaki T.
        • Xiao J.Z.
        Enriched metabolites that potentially promote age-associated diseases in subjects with an elderly-type gut microbiota.
        Gut Microbes. 2021; 13: 1-11
        • Steimbach R.R.
        • Herbst-Gervasoni C.J.
        • Lechner S.
        • Stewart T.M.
        • Klinke G.
        • Ridinger J.
        • et al.
        Aza-SAHA derivatives are selective histone deacetylase 10 chemical probes that inhibit polyamine deacetylation and phenocopy HDAC10 knockout.
        ChemRxiv. 2022; (https://dx.doi.org/10.26434/chemrxiv-2021-37shs-v2)
        • Murray Stewart T.
        • Dunston T.T.
        • Woster P.M.
        • Casero Jr., R.A.
        Polyamine catabolism and oxidative damage.
        J. Biol. Chem. 2018; 293: 18736-18745
        • Alexander E.T.
        • El Naggar O.
        • Fahey E.
        • Mariner K.
        • Donnelly J.
        • Wolfgang K.
        • et al.
        Harnessing the polyamine transport system to treat BRAF inhibitor-resistant melanoma.
        Cancer Biol. Ther. 2021; 22: 225-237
        • Alexander E.T.
        • Mariner K.
        • Donnelly J.
        • Phanstiel O.
        • Gilmour S.K.
        Polyamine blocking therapy decreases survival of tumor-infiltrating immunosuppressive myeloid cells and enhances the antitumor efficacy of PD-1 blockade.
        Mol. Cancer Ther. 2020; 19: 2012-2022
        • Gitto S.B.
        • Pandey V.
        • Oyer J.L.
        • Copik A.J.
        • Hogan F.C.
        • Phanstiel O.t.
        • et al.
        Difluoromethylornithine combined with a polyamine transport inhibitor is effective against gemcitabine resistant pancreatic cancer.
        Mol. Pharm. 2018; 15: 369-376
        • Muth A.
        • Madan M.
        • Archer J.J.
        • Ocampo N.
        • Rodriguez L.
        • Phanstiel O.
        Polyamine transport inhibitors: Design, synthesis, and combination therapies with difluoromethylornithine.
        J. Med. Chem. 2014; 57: 348-363
        • Blankenship J.
        • Marchant P.E.
        Metabolism of N1-acetylspermidine and N8-acetylspermidine in rats.
        Proc. Soc. Exp. Biol. Med. 1984; 177: 180-187
        • Seiler N.
        Catabolism of polyamines.
        Amino Acids. 2004; 26: 217-233
        • Wallace H.M.
        • Mackarel A.J.
        Regulation of polyamine acetylation and efflux in human cancer cells.
        Biochem. Soc. Trans. 1998; 26: 571-575
        • Xie X.
        • Gillies R.J.
        • Gerner E.W.
        Characterization of a diamine exporter in Chinese hamster ovary cells and identification of specific polyamine substrates.
        J. Biol. Chem. 1997; 272: 20484-20489
        • Nakajima T.
        • Katsumata K.
        • Kuwabara H.
        • Soya R.
        • Enomoto M.
        • Ishizaki T.
        • et al.
        Urinary polyamine biomarker panels with machine-learning differentiated colorectal cancers, benign disease, and healthy controls.
        Int. J. Mol. Sci. 2018; 19https://doi.org/10.3390/ijms19030756
        • Udo R.
        • Katsumata K.
        • Kuwabara H.
        • Enomoto M.
        • Ishizaki T.
        • Sunamura M.
        • et al.
        Urinary charged metabolite profiling of colorectal cancer using capillary electrophoresis-mass spectrometry.
        Sci. Rep. 2020; 10: 21057
        • Löser C.
        • Fölsch U.R.
        • Paprotny C.
        • Creutzfeldt W.
        Polyamines in colorectal cancer. Evaluation of polyamine concentrations in the colon tissue, serum, and urine of 50 patients with colorectal cancer.
        Cancer. 1990; 65: 958-966
        • Weiss T.S.
        • Herfarth H.
        • Obermeier F.
        • Ouart J.
        • Vogl D.
        • Scholmerich J.
        • et al.
        Intracellular polyamine levels of intestinal epithelial cells in inflammatory bowel disease.
        Inflamm. Bowel Dis. 2004; 10: 529-535
        • Rao J.N.
        • Xiao L.
        • Wang J.Y.
        Polyamines in gut epithelial renewal and barrier function.
        Physiology (Bethesda). 2020; 35: 328-337
        • Nakamura A.
        • Kurihara S.
        • Takahashi D.
        • Ohashi W.
        • Nakamura Y.
        • Kimura S.
        • et al.
        Symbiotic polyamine metabolism regulates epithelial proliferation and macrophage differentiation in the colon.
        Nat. Commun. 2021; 12: 2105
        • Ferioli M.E.
        • Sessa A.
        • Tunici P.
        • Pinotti O.
        • Perin A.
        Aging and polyamine acetylation in rat kidney.
        Biochim. Biophys. Acta. 1996; 1317: 15-18
        • Minois N.
        • Carmona-Gutierrez D.
        • Madeo F.
        Polyamines in aging and disease.
        Aging. 2011; 3: 716-732
        • Tong J.J.
        • Liu J.
        • Bertos N.R.
        • Yang X.J.
        Identification of HDAC10, a novel class II human histone deacetylase containing a leucine-rich domain.
        Nucleic Acids Res. 2002; 30: 1114-1123
        • Viltard M.
        • Durand S.
        • Perez-Lanzon M.
        • Aprahamian F.
        • Lefevre D.
        • Leroy C.
        • et al.
        The metabolomic signature of extreme longevity: Naked mole rats versus mice.
        Aging. 2019; 11: 4783-4800
        • Uhlen M.
        • Zhang C.
        • Lee S.
        • Sjostedt E.
        • Fagerberg L.
        • Bidkhori G.
        • et al.
        A pathology atlas of the human cancer transcriptome.
        Science. 2017; 357https://doi.org/10.1126/science.aan2507
        • Zhang T.
        • Wang B.
        • Gu B.
        • Su F.
        • Xiang L.
        • Liu L.
        • et al.
        Genetic and molecular characterization revealed the prognosis efficiency of histone acetylation in pan-digestive cancers.
        J. Oncol. 2022; 2022: 3938652
        • Yang Y.
        • Huang Y.
        • Wang Z.
        • Wang H.T.
        • Duan B.
        • Ye D.
        • et al.
        HDAC10 promotes lung cancer proliferation via AKT phosphorylation.
        Oncotarget. 2016; 7: 59388-59401
        • Porter C.W.
        • Cavanaugh Jr., P.F.
        • Stolowich N.
        • Ganis B.
        • Kelly E.
        • Bergeron R.J.
        Biological properties of N4- and N1,N8-spermidine derivatives in cultured L1210 leukemia cells.
        Cancer Res. 1985; 45: 2050-2057
        • Mamont P.S.
        • Seiler N.
        • Siat M.
        • Joder-Ohlenbusch A.M.
        • Knodgen B.
        Metabolism of acetyl derivatives of polyamines in cultured polyamine-deficient rat hepatoma cells.
        Med. Biol. 1981; 59: 347-353
        • Conway L.P.
        • Rendo V.
        • Correia M.S.P.
        • Bergdahl I.A.
        • Sjöblom T.
        • Globisch D.
        Unexpected acetylation of endogenous aliphatic amines by arylamine N-acetyltransferase NAT2.
        Angew. Chem. Int. Ed. Engl. 2020; 59: 14342-14346
        • Hayes C.S.
        • Shicora A.C.
        • Keough M.P.
        • Snook A.E.
        • Burns M.R.
        • Gilmour S.K.
        Polyamine-blocking therapy reverses immunosuppression in the tumor microenvironment.
        Cancer Immunol. Res. 2014; 2: 274-285
        • Weeks R.S.
        • Vanderwerf S.M.
        • Carlson C.L.
        • Burns M.R.
        • O'Day C.L.
        • Cai F.
        • et al.
        Novel lysine-spermine conjugate inhibits polyamine transport and inhibits cell growth when given with DFMO.
        Exp. Cell Res. 2000; 261: 293-302
        • Burns M.R.
        • Graminski G.F.
        • Weeks R.S.
        • Chen Y.
        • O'Brien T.G.
        Lipophilic lysine-spermine conjugates are potent polyamine transport inhibitors for use in combination with a polyamine biosynthesis inhibitor.
        J. Med. Chem. 2009; 52: 1983-1993
        • Chin A.
        • Bieberich C.J.
        • Stewart T.M.
        • Casero R.A.
        Polyamine depletion strategies in cancer: remodeling the tumor immune microenvironment to enhance anti-tumor responses.
        Med. Sci. 2022; 10: 31https://doi.org/10.3390/medsci10020031
        • Sanjana N.E.
        • Shalem O.
        • Zhang F.
        Improved vectors and genome-wide libraries for CRISPR screening.
        Nat. Methods. 2014; 11: 783-784
        • Kabra P.M.
        • Lee H.K.
        • Lubich W.P.
        • Marton L.J.
        Solid-phase extraction and determination of dansyl derivatives of unconjugated and acetylated polyamines by reversed-phase liquid chromatography: Improved separation systems for polyamines in cerebrospinal fluid, urine and tissue.
        J. Chromatogr. 1986; 380: 19-32