Advertisement

Elucidation of the substrate of tRNA-modifying enzymes MnmEG leads to in vitro reconstitution of an evolutionarily conserved uridine hypermodification

Open AccessPublished:September 28, 2022DOI:https://doi.org/10.1016/j.jbc.2022.102548
      The evolutionarily conserved bacterial proteins MnmE and MnmG collectively install a carboxymethylaminomethyl (cmnm) group at the fifth position of wobble uridines of several tRNA species. While the reaction catalyzed by MnmEG is one of the central steps in the biosynthesis of the methylaminomethyl (mnm) posttranscriptional tRNA modification, details of the reaction remain elusive. Glycine is known to be the source of the carboxy methylamino moiety of cmnm, and a tetrahydrofolate (THF) analog is thought to supply the one carbon that is appended to the fifth position of U. However, the nature of the folate analog remains unknown. This article reports the in vitro biochemical reconstitution of the MnmEG reaction. Using isotopically labeled methyl and methylene THF analogs, we demonstrate that methylene THF is the true substrate. We also show that reduced FAD is required for the reaction and that DTT can replace the NADH in its role as a reductant. We discuss the implications of these methylene-THF and reductant requirements on the mechanism of this key tRNA modification catalyzed by MnmEG.

      Keywords

      Abbreviations:

      Cmnm (carboxymethylaminomethyl), EIC (extracted ion chromatograms), HRMS (high resolution mass spectrometry), LB (Lennox broth), mnm (methylaminomethyl), MTHFR (methylenetetrahydrofolate reductase), MWCO (molecular weight cut off), SHMT (serine hydroxymethyltransferase), SIM (selected ion monitoring), TCA (trichloroacetic acid), THF (tetrahydrofolate)
      Posttranscriptional modifications are present in all cellular RNA pools and many are conserved across all domains of life. To date, ∼140 posttranscriptional nucleoside modifications have been reported in the MODOMICS database, highlighting their importance and ubiquity (
      • Boccaletto P.
      • MacHnicka M.A.
      • Purta E.
      • Pitkowski P.
      • Baginski B.
      • Wirecki T.K.
      • et al.
      MODOMICS: a database of RNA modification pathways. 2017 update.
      ). In particular, tRNA is one of the most extensively modified cellular RNA species, with the majority of modifications concentrated on the anticodon stem loop (
      • Björk G.R.
      • Hagervall T.G.
      Transfer RNA modification: presence, synthesis, and function.
      ). Some modifications are introduced by a single step, while many are hypermodifications that are installed by complex multienzyme pathways (
      • Björk G.R.
      • Hagervall T.G.
      Transfer RNA modification: presence, synthesis, and function.
      ,
      • Miles Z.D.
      • McCarty R.M.
      • Molnar G.
      • Bandarian V.
      Discovery of epoxyqueuosine (oQ) reductase reveals parallels between halorespiration and tRNA modification.
      ,
      • McCarty R.M.
      • Somogyi Á.
      • Lin G.
      • Jacobsen N.E.
      • Bandarian V.
      The deazapurine biosynthetic pathway revealed: in vitro enzymatic synthesis of PreQ0 from guanosine 5′-triphosphate in four steps.
      ,
      • Okada N.
      • Nishimura S.
      Isolation and characterization of a guanine insertion enzyme, a specific tRNA transglycosylase, from Escherichia coli.
      ,
      • Slany R.K.
      • Bösl M.
      • Crain P.F.
      • Kersten H.
      A new function of S-adenosylmethionine: the ribosyl moiety of AdoMet is the precursor of the cyclopentenediol moiety of the tRNA wobble base queuine.
      ,
      • Young A.P.
      • Bandarian V.
      Radical mediated ring formation in the biosynthesis of the hypermodified tRNA base wybutosine.
      ,
      • Noma A.
      • Kirino Y.
      • Ikeuchi Y.
      • Suzuki T.
      Biosynthesis of wybutosine, a hyper-modified nucleoside in eukaryotic phenylalanine tRNA.
      ,
      • Esberg B.
      • Leung H.C.E.
      • Tsui H.C.T.
      • Bjork G.R.
      • Winkler M.E.
      Identification of the miaB gene, involved in methylthiolation of isopentenylated A37 derivatives in the tRNA of Salmonella typhimurium and Escherichia coli.
      ).
      Modifications present on wobble uridines (position 34) of tRNA can be grouped based on the atom attached to the C-5 of the uracil (
      • Armengod M.E.
      • Meseguer S.
      • Villarroya M.
      • Prado S.
      • Moukadiri I.
      • Ruiz-Partida R.
      • et al.
      Modification of the wobble uridine in bacterial and mitochondrial tRNAs reading NNA/NNG triplets of 2-codon boxes.
      ) (Fig. 1). 5-Hydroxyuridine (xo5U) derivatives contain an oxygen atom bonded to position 5, whereas 5-methyluridine (xm5U) derivatives contain a methylene group attached to the uridine's position 5. Some of these wobble uridine modifications, such as the xo5U derivatives, expand anticodon recognition to three or four synonymous codons (
      • Armengod M.E.
      • Meseguer S.
      • Villarroya M.
      • Prado S.
      • Moukadiri I.
      • Ruiz-Partida R.
      • et al.
      Modification of the wobble uridine in bacterial and mitochondrial tRNAs reading NNA/NNG triplets of 2-codon boxes.
      ,
      • Weixlbaumer A.
      • Murphy IV F.V.
      • Dziergowska A.
      • Malkiewicz A.
      • Vendeix F.A.P.
      • Agris P.F.
      • et al.
      Mechanism for expanding the decoding capacity of transfer RNAs by modification of uridines.
      ,
      • Näsvall S.J.
      • Chen P.
      • Björk G.R.
      The modified wobble nucleoside uridine-5-oxyacetic acid in tRNAProcmo5UGG promotes reading of all four proline codons in vivo.
      ). By contrast, the xm5U derivatives are essential for the accurate translation of codons ending in A or G (NNA and NNG), while impeding the base pairing with codons ending in C and U (
      • Armengod M.E.
      • Meseguer S.
      • Villarroya M.
      • Prado S.
      • Moukadiri I.
      • Ruiz-Partida R.
      • et al.
      Modification of the wobble uridine in bacterial and mitochondrial tRNAs reading NNA/NNG triplets of 2-codon boxes.
      ). The importance of wobble uridine modifications is underscored by the fact that the loss of xm5U modifications in human mitochondria is seen in patients with mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS) and myoclonus epilepsy with ragged-red fibers (MERRF) (
      • Kirino Y.
      • Suzuki T.
      Human mitochondrial diseases associated with tRNA wobble modification deficiency.
      ,
      • Suzuki T.
      • Nagao A.
      • Suzuki T.
      Human mitochondrial trnas: biogenesis, function, structural aspects, and diseases.
      ,
      • Kirino Y.
      • Yasukawa T.
      • Ohta S.
      • Akira S.
      • Ishihara K.
      • Watanabe K.
      • et al.
      Codon-specific translational defect caused by a wobble modification deficiency in mutant tRNA from a human mitochondrial disease.
      ,
      • Goto Y.I.
      • Nonaka I.
      • Horai S.
      A mutation in the tRNALeu(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies.
      ,
      • Kobayashi Y.
      • Momoi M.Y.
      • Tominaga K.
      • Shimoizumi H.
      • Nihei K.
      • Yanagisawa M.
      • et al.
      Respiration-deficient cells are caused by a single point mutation in the mitochondrial tRNA-Leu (UUR) gene in mitochondrial myopathy, encephalopathy, lactic acidosis, and strokelike episodes (MELAS).
      ,
      • Shoffner J.M.
      • Lott M.T.
      • Lezza A.M.S.
      • Seibel P.
      • Ballinger S.W.
      • Wallace D.C.
      Myoclonic epilepsy and ragged-red fiber disease (MERRF) is associated with a mitochondrial DNA tRNALys mutation.
      ).
      Figure thumbnail gr1
      Figure 1Wobble uridine tRNA modifications. A, structures of xm5U and xo5U modifications where position 5 (denoted in red) of the base is modified. B, representative example of bacterial mnm pathway. The enzymatic reaction of interest in the current report is highlighted in red.
      5-Carboxymethylaminomethyl (cmnm5) and 5-methylaminomethyl (mnm5) are two xm5U derivatives found at the wobble uridines of bacterial tRNA. The biogenesis of the mnm5 sidechain is initiated by MnmE and MnmG, which collectively convert U34 of tRNAArg, tRNAGln, tRNAGlu, tRNAGly, tRNALeu, and tRNALys when present to their corresponding cmnm5U34 derivatives (
      • Boccaletto P.
      • MacHnicka M.A.
      • Purta E.
      • Pitkowski P.
      • Baginski B.
      • Wirecki T.K.
      • et al.
      MODOMICS: a database of RNA modification pathways. 2017 update.
      ,
      • Armengod M.E.
      • Moukadiri I.
      • Prado S.
      • Ruiz-Partida R.
      • Benítez-Páez A.
      • Villarroya M.
      • et al.
      Enzymology of tRNA modification in the bacterial MnmEG pathway.
      ,
      • Moukadiri I.
      • Prado S.
      • Piera J.
      • Velázquez-campoy A.
      • Björk G.R.
      • Armengod M.E.
      Evolutionarily conserved proteins MnmE and GidA catalyze the formation of two methyluridine derivatives at tRNA wobble positions.
      ,
      • Brégeon D.
      • Colot V.
      • Radman M.
      • Taddei F.
      Translational misreading: a tRNA modification counteracts a +2 ribosomal frameshift.
      ,
      • Elseviers D.
      • Petrullo L.A.
      • Gallagher P.J.
      Novel E. coli mutants deficient in blosynthesis of 5-methylamlnomethyl-2-thiouridine.
      ) (Fig. 1). The bifunctional enzyme MnmC catalyzes the flavin-dependent cleavage of the carboxymethyl moiety to form the aminomethyl (nm5), as well as S-adenosyl-L-methionine–dependent methylation to the mnm5 on tRNAs for Arg, Glu, Gly, and Lys (
      • Bujnicki J.M.
      • Oudjama Y.
      • Roovers M.
      • Owczarek S.
      • Caillet J.
      • Droogmans L.
      Identification of a bifunctional enzyme MnmC involved in the biosynthesis of a hypermodified uridine in the wobble position of tRNA.
      ,
      • Hagervall T.G.
      • Björk G.R.
      Genetic mapping and cloning of the gene (trmC) responsible for the synthesis of tRNA (mnm5s2U)methyltransferase in Escherichia coli K12.
      ). In Leu tRNA, 2′-hydroxyl is further methylated by TrmL to convert to cmnm5Um (
      • Boccaletto P.
      • MacHnicka M.A.
      • Purta E.
      • Pitkowski P.
      • Baginski B.
      • Wirecki T.K.
      • et al.
      MODOMICS: a database of RNA modification pathways. 2017 update.
      ,
      • Benítez-Páez A.
      • Villarroya M.
      • Douthwaite S.
      • Gabaldón T.
      • Armengod M.E.
      YibK is the 2′-O-methyltransferase TrmL that modifies the wobble nucleotide in Escherichia coli tRNALeu isoacceptors.
      ). The thiolation at C-2 is catalyzed by MnmA and occurs independently of the modifications at C-5 on tRNAs for Gln, Glu, and Lys (
      • Kambampati R.
      • Lauhon C.T.
      Mnma and IscS are required for in vitro 2-thiouridine biosynthesis in Escherichia coli.
      ). When sufficient quantities of selenium are present in growth media, the SelU (or MnmH) inserts selenium at C-2 to form mnm5se2U in a fraction of tRNAs for Lys and Glu, completing the hypermodification pathway (
      • Wittwer A.J.
      • Stadtman T.C.
      Biosynthesis of 5-methylaminomethyl-2-selenouridine, a naturally occurring nucleoside in Escherichia coli tRNA.
      ,
      • Jäger G.
      • Chen P.
      • Björk G.R.
      Transfer RNA bound to MnmH protein is enriched with geranylated tRNA-A possible intermediate in its selenation?.
      ,
      • Szczupak P.
      • Sierant M.
      • Wielgus E.
      • Radzikowska-Cieciura E.
      • Kulik K.
      • Krakowiak A.
      • et al.
      Escherichia coli tRNA 2-selenouridine synthase (SelU): elucidation of substrate specificity to understand the role of S-geranyl-tRNA in the conversion of 2-Thio-into 2-selenouridines in bacterial tRNA.
      ). The wobble xm5U modifications in mitochondrial tRNA are carried out by the homologs of MnmE and MnmG (such as MSS1 and MTO1 in Saccharomyces cerevisiae (
      • Wang X.
      • Yan Q.
      • Guan M.X.
      Combination of the loss of cmnm5U34 with the lack of s2U34 modifications of tRNALys, tRNAGlu, and tRNAGln altered mitochondrial biogenesis and Respiration.
      ) or hGTPBP3 and hMTO1 in humans (
      • Suzuki T.
      • Suzuki T.
      • Wada T.
      • Saigo K.
      • Watanabe K.
      Taurine as a constituent of mitochondrial tRNAs: new insights into the functions of taurine and human mitochondrial diseases.
      ), see Fig. S1). However, taurine is appended instead of glycine to form a taurinomethyl (τm5) modified base (
      • Suzuki T.
      • Suzuki T.
      • Wada T.
      • Saigo K.
      • Watanabe K.
      Taurine as a constituent of mitochondrial tRNAs: new insights into the functions of taurine and human mitochondrial diseases.
      ). 5-Taurinomethyluridine (τm5U) and 5-taurinomethyl-2-thiouridine (τm5s2U) are examples of xm5U in human mitochondria (
      • Suzuki T.
      • Suzuki T.
      • Wada T.
      • Saigo K.
      • Watanabe K.
      Taurine as a constituent of mitochondrial tRNAs: new insights into the functions of taurine and human mitochondrial diseases.
      ).
      While the role of the MnmEG complex (or its eukaryotic counterparts) in the cmnm modification is not disputed, several key aspects of this reaction remain unknown. First, MnmE has been shown to bind tetrahydrofolate (THF) and its derivatives such as methylTHF (CH3THF), methylene THF (CH2THF), and N5 or N10 – formylTHF (CHO-THF) with a similar affinity (
      • Moukadiri I.
      • Prado S.
      • Piera J.
      • Velázquez-campoy A.
      • Björk G.R.
      • Armengod M.E.
      Evolutionarily conserved proteins MnmE and GidA catalyze the formation of two methyluridine derivatives at tRNA wobble positions.
      ) (see Fig. S2 for structures). Interestingly, while THF does not have an available one-carbon unit at N5 to donate to the reaction, it has been shown that under some conditions, it can support the formation of the modified uridine base, suggesting that the enzyme likely copurifies with the true substrate for the reaction (
      • Moukadiri I.
      • Prado S.
      • Piera J.
      • Velázquez-campoy A.
      • Björk G.R.
      • Armengod M.E.
      Evolutionarily conserved proteins MnmE and GidA catalyze the formation of two methyluridine derivatives at tRNA wobble positions.
      ). Cocrystallization of 5-CHO-THF with MnmE has been taken as potential evidence that a formyl moiety is the source of the one-carbon (
      • Scrima A.
      • Vetter I.R.
      • Armengod M.E.
      • Wittinghofer A.
      The structure of the TrmE GTP-binding protein and its implications for tRNA modification.
      ). However, the enzyme is unlikely to be as promiscuous as these studies suggest. Indeed, CH3-, CH2-, and CHO-THF each present a one-carbon unit at a distinct oxidation state; moreover, THF does not carry a one-carbon unit.
      The uncertainty likely results from the complex mixtures of THF species that often constitute commercially available THF derivatives, their well-known propensity to oxidation under aerobic conditions, and the ability of the enzyme to bind various THF analogs. As a counterpoint, studies examining mnm5 modification in strains that lack various genes in the biogenesis of the THF and its derivatives suggest that the one-carbon unit is derived from CH2THF (
      • Waller J.C.
      • Alvarez S.
      • Naponelli V.
      • Lara-Nuñez A.
      • Blaby I.K.
      • Da Silva V.
      • et al.
      A role for tetrahydrofolates in the metabolism of iron-sulfur clusters in all domains of life.
      ,
      • Morscher R.J.
      • Ducker G.S.
      • Li S.H.J.
      • Mayer J.A.
      • Gitai Z.
      • Sperl W.
      • et al.
      Mitochondrial translation requires folate-dependent tRNA methylation.
      ) (summarized in Fig. S3). However, there have been no studies that directly implicate the source of the one-carbon unit delivered by THF analog in vitro and in fact, as discussed previously, virtually all forms of THF have been proposed to support turnover. A second confounding issue is the role of a pyridine nucleotide in the reaction. NADH (but not NADPH) is required for the reaction (
      • Moukadiri I.
      • Prado S.
      • Piera J.
      • Velázquez-campoy A.
      • Björk G.R.
      • Armengod M.E.
      Evolutionarily conserved proteins MnmE and GidA catalyze the formation of two methyluridine derivatives at tRNA wobble positions.
      ). However, NADH was dispensable at higher FAD concentrations. This interdependence of NADH and FAD concentrations is also not understood. Despite all the studies, many questions remain about the exact nature of the mechanism of installation of the cmnm5 group by MnmEG.
      Herein, we report in vitro biochemical reconstitution of the MnmEG reaction using well-defined isotopically enriched substrates. We show that while the protein copurifies with a variety of THF analogs when incubated with isotopically enriched CH2THF, isotope transfer from the THF analog to the product occurs. Moreover, we show that the reaction requires NADH but DTT can substitute in its absence. Spectrophotometric measurements with MnmEG clearly show that the endogenous FAD is reduced by NADH (or DTT). These observations lead to an outline of the mechanism of MnmEG that allow its classification as being analogous to FAD/folate-dependent C5 uracil methyl transferase proteins.

      Results

      MnmE and MnmG copurify with substrates and cofactors

      MnmE and MnmG were expressed in Escherichia coli and purified to homogeneity via anion exchange and hydrophobic interaction chromatographic steps (see Fig. S4A for SDS-PAGE analysis). The GTPase MnmE has been shown to bind various THF derivatives with a similar affinity (
      • Moukadiri I.
      • Prado S.
      • Piera J.
      • Velázquez-campoy A.
      • Björk G.R.
      • Armengod M.E.
      Evolutionarily conserved proteins MnmE and GidA catalyze the formation of two methyluridine derivatives at tRNA wobble positions.
      ) and could copurify with the THF derivatives bound. Similarly, the flavoenzyme MnmG could copurify with the flavin cofactor. The protein solutions were dialyzed extensively before being concentrated to minimize the possibility of bound small molecules that could confound the results. However, to establish a baseline for all bound THF and flavin, the purified proteins were analyzed after denaturation with trichloroacetic acid (TCA). The analyses were carried out using HPLC–high resolution mass spectrometry (HRMS) analysis, and the resulting HPLC traces and MS data are shown in Figure 2.
      Figure thumbnail gr2
      Figure 2Analysis of small molecules that copurify with MnmE and MnmG. A, the TIC of MnmE TCA precipitate (black) and EICs of THF (m/z – 446.17 ± 0.01, blue), CH2THF (m/z - 458.17 ± 0.01, blue), and CH3THF (m/z – 460.19 ± 0.01, green) from MnmE supernatant in comparison with commercially sourced CH2THF and CH3THF standards. B, representative mass spectra of the THF, CH2THF, and CH3THF observed in the MnmE supernatant sample C, representative LC trace at UV 446 nm from MnmG supernatant (red) and the observed mass spectrum for the FAD peak eluting at 9.13 min (blue). D, comparison of UV-vis spectra of intact MnmG (red), MnmG supernatant after TCA precipitation (blue), and commercially sourced FAD (black). The protein sample spectrum comparisons are made against ∼ 58 μM of authentic FAD. EIC, extracted ion chromatograms; LC, liquid chromatography; TCA, trichloroacetic acid; TIC, total ion chromatogram; THF, tetrahydrofolate.
      The analysis of multiple MnmE preparations purified for this study shows that it indeed copurifies with THF, CH2THF, and CH3THF. The total ion chromatograms of supernatants from acid denatured MnmE depicted in Figure 2A (black trace) show that these molecules elute near one another under the employed liquid chromatography conditions. However, they can be clearly identified in the extracted ion chromatograms (EICs) and by comparison of their retention times to those of commercially sourced reagents. The mass spectra observed for the peaks at retention times 8.9, 9.1, and 9.3 min display m/z values of 446.17, 458.17, and 460.19, respectively, which are within 1 ppm of those expected for THF, CH2THF, and CH3THF, respectively (Fig. 2B). We also have mass spectrometric evidence for the presence of methenylTHF and traces of formylTHF (Fig. S5). Therefore, despite extensive efforts to remove any noncovalently associated molecules, the enzyme preparations carry measurable quantities of folates.
      MnmG has previously been shown to be a flavoenzyme (
      • Shi R.
      • Villarroya M.
      • Ruiz-Partida R.
      • Li Y.
      • Proteau A.
      • Prado S.
      • et al.
      Structure-function analysis of Escherichia coli MnmG (GidA), a highly conserved tRNA-modifying enzyme.
      • White D.J.
      • Merod R.
      • Thomasson B.
      • Hartzell P.L.
      GidA is an FAD-binding protein involved in development of Myxococcus xanthus.
      ). Purified recombinant E. coli MnmG is yellow, and the UV-visible spectrum of the protein (Fig. 2D) exhibits features at ∼350 and 450 nm, consistent with the presence of flavin. Upon treatment with TCA, the cofactor is released, and the spectrum of the cofactor in the solution is indistinguishable from free flavin (compare blue and black traces in Fig. 2D). To identify the nature of the bound flavin, supernatants from TCA-precipitated MnmG samples were analyzed by HPLC-MS. The MS of the species eluting at 9.13 min with the characteristic UV-visible features of flavin reveals an m/z value of 786.16, which is consistent with FAD (blue trace, Fig. 2C). Quantification of the FAD in the MnmG protein shows that it is not replete with flavin. In two different preparations of the protein used in these studies, the ratio of FAD to MnmG was found to be ∼1:5 to 1:6. Therefore, unless indicated otherwise, in the experiments described later, exogenous FAD was added to the assays to ensure maximal occupancy of the flavin-binding sites.

      In vitro reconstitution of MnmEG reaction

      The collective actions of MnmEG are responsible for wobble uridine modification on tRNA in a reaction that utilizes glycine and a THF derivative as the cosubstrates (
      • Armengod M.E.
      • Moukadiri I.
      • Prado S.
      • Ruiz-Partida R.
      • Benítez-Páez A.
      • Villarroya M.
      • et al.
      Enzymology of tRNA modification in the bacterial MnmEG pathway.
      ). We sought to reconstitute the activity of MnmEG in vitro to probe the identity of the THF derivative. Since the flavin cofactor and the THF derivatives required for the MnmEG reaction are sensitive to air oxidation, all the assays were carried out in a glovebox under anoxic conditions. The hypomodified tRNA substrate for the reaction was obtained in the form of total tRNA from a ΔmnmE deletion strain of E. coli (Fig. S4B). In our initial assays, we supplied CH3THF or CH2THF in trans, along with FAD, NADH, GTP, and glycine. The reaction was allowed to proceed overnight (12–14 h) at 37 °C. The analysis for the presence of cmnm5s2U entailed extracting the tRNA from the reaction mixtures and digesting it to nucleosides using P1 nuclease, phosphodiesterase, and alkaline phosphatase and HPLC-HRMS analysis of the resulting nucleoside mixtures (
      • Young A.P.
      • Bandarian V.
      TYW1: a radical SAM enzyme involved in the biosynthesis of wybutosine bases.
      ,
      • Bommisetti P.
      • Bandarian V.
      Site-specific profiling of 4-thiouridine across transfer RNA genes in Escherichia coli.
      ).
      The red traces in Figure 3A show UV chromatograms for a mixture of standard nucleosides (A, U, G, C, s2U, and s4U) and nucleosides obtained from digesting total tRNA from ΔmnmE E. coli. The nucleosides used as standards are well separated and allow for the assignment of peaks due to A, U, G, and C in the E. coli tRNA. The EIC trace at m/z = 261.05 for the digested ΔmnmE E. coli tRNA that is not treated with MnmEG shows peaks at 9 and 9.5 min, corresponding to the isobaric thiolated nucleosides s2U and s4U, respectively. In our experience working with thiolated nucleosides (s2U and s4U (
      • Bommisetti P.
      • Bandarian V.
      Site-specific profiling of 4-thiouridine across transfer RNA genes in Escherichia coli.
      )), we observed that their MS signals are suppressed in the context of tRNA samples. To increase sensitivity, we employed selected ion monitoring (SIM) between 3 and 7 min to search for cmnm5s2U in the analysis of nucleosides from tRNA samples in reaction mixtures. The EIC corresponding to the mass of cmnm5s2U from a SIM experiment shows a peak at ∼4 min in the ΔmnmE E. coli tRNA sample treated with MnmEG. The observed mass spectra for s2U and cmnm5s2U from untreated and treated tRNA samples are shown in Figure 3B. As indicated previously, the thiolated nucleosides do not ionize well; therefore, their MS intensities are relatively weak. However, the peak for cmnm5s2U is clearly observed after treatment with MnmEG, and the observed m/z values for these nucleosides are within 3 ppm of theoretical values.
      Figure thumbnail gr3
      Figure 3HPLC-HRMS analysis of the tRNA nucleosides. A, representative PDA traces of nucleosides from either commercially sources or tRNA (red) and EICs of s2U (m/z - 261.05 ± 0.01) and cmnm5s2U (m/z – 348.08 ± 0.01) nucleosides from untreated and treated samples respectively (blue). B, representative mass spectra of the s2U and cmnm5s2U observed in untreated and treated samples, respectively, shown in (A) (blue trace). C, EICs of the cmnm5s2U (m/z – 348.08 ± 0.01) product from reaction samples obtained by omitting one reagent at a time. D, EICs of the s2U (m/z - 261.05 ± 0.01) nucleoside from reaction samples obtained by omitting one reagent at a time. The reaction samples are labeled in (A) and the omitted reagents are labeled for each of the traces in (C) and (D). Cmnm, carboxymethylaminomethyl; EIC, extracted ion chromatograms; HRMS, high resolution mass spectrometry; PDA, photodiode array.
      We next examined the role of various components of the assay mixture on the formation of cmnm5s2U (Fig. 3C) from s2U (Fig. 3D). The EIC traces show that in the presence of GTP, glycine, CH2THF, FAD, and NADH, the formation of cmnm5s2U is observed to be concomitant with the depletion of s2U. Removing MnmEG or the tRNA substrate abolishes the peak for cmnm5s2U. Interestingly, in the absence of glycine, s2U is depleted but no product forms. This observation may suggest a possible mechanistic paradigm for the MnmEG reaction (see Discussion). Curiously, however, we still observe the product even if FAD, NADH, or CH2THF are absent. These observations align with previous reports that product forms even in the presence of THF, which does not carry one carbon unit. Alternatively, we observe that CH3THF also supports product formation in a similar manner (Fig. S6). These seemingly contradictory observations on the role of THF are all likely because the protein copurifies with all the necessary components for at least one turnover. Since the enzymes are present in far excess over the substrate, which is likely a very small fraction of the total tRNA obtained from the deletion strain, it is not surprising that conversion is seen even in the absence of a THF substrate. However, we note that no product forms in the absence of GTP, pointing to the key role that the hydrolysis of the nucleotide plays in the reaction (
      • Meyer S.
      • Wittinghofer A.
      • Versées W.
      G-domain dimerization orchestrates the tRNA wobble modification reaction in the MnmE/GidA complex.
      ,
      • Fislage M.
      • Brosens E.
      • Deyaert E.
      • Spilotros A.
      • Pardon E.
      • Loris R.
      • et al.
      SAXS analysis of the tRNA-modifying enzyme complex MnmE/MnmG reveals a novel interaction mode and GTP-induced oligomerization.
      ,
      • Monleón D.
      • Martínez-Vicente M.
      • Esteve V.
      • Yim L.
      • Prado S.
      • Armengod M.E.
      • et al.
      Structural insights into the GTPase domain of Escherichia coli MnmE protein.
      ). These observations highlight and amplify ambiguities in the literature on the nature of the THF analog employed by MnmEG.

      Methylene source at the C5 of the uridine

      To directly probe the source of the carbon incorporated into the modified base, we synthesized THF derivatives where the appended one carbon unit was isotopically enriched. The isotopically enriched CH2THF isotopologs 13CH2THF and CD2THF were prepared by incubating serine hydroxymethyltransferase (SHMT) and THF with β-13C-serine or β-CD2-serine (
      • Waller J.C.
      • Alvarez S.
      • Naponelli V.
      • Lara-Nuñez A.
      • Blaby I.K.
      • Da Silva V.
      • et al.
      A role for tetrahydrofolates in the metabolism of iron-sulfur clusters in all domains of life.
      ,
      • Green J.M.
      • Matthews R.G.
      Folate biosynthesis, reduction, and Polyglutamylation and the interconversion of folate derivatives.
      ) (Fig. 4A). The 13CH3THF isotopolog was prepared by two different routes from the 13CH2THF (described before) after filtering out the SHMT and reduction as follows. In the first, 13CH2THF was reduced enzymatically with methylenetetrahydrofolate reductase (MTHFR) and NADH (Fig. 4A). Alternatively, the filtrate containing 13CH2THF was treated with NaCNBH3 to obtain 13CH3THF (
      • Wang B.
      • Jorns M.S.
      Reconstitution of Escherichia coli DNA Photolyase with various folate derivatives.
      ) (Fig. 4A). The synthetic THF analogs were examined by LC-MS, and Figure 4B shows the MS corresponding to the chromatogram region corresponding to the analogs. While CH2THF has an m/z of 458.17, the synthetic 13CH2THF isotopolog has an m/z of 459.17, which is consistent with the presence of a 13C. The corresponding deuterated isotopolog (CD2THF) exhibits an m/z of 460.19, consistent with the presence of two deuterium atoms. The reduction of 13CH2THF with NaCNBH3 cleanly yields the corresponding reduced 13CH3THF (m/z of 461.19), with only a trace amount of 13CH2THF remaining. By contrast, reduction with MTHFR/NADH yields a mixture of 13CH2THF (m/z = 459.17) and 13CH3THF (m/z = 461.19).
      Figure thumbnail gr4
      Figure 4Preparation and use with isotopically labeled THF derivatives in MnmEG reaction. A, schematic showing SHMT-based synthetic route to 13CH2THF and CD2THF, using β-13C-serine and β-CD2-serine, respectively. Reduction of 13CH2THF with NaCNBH3 or MTHFR/NADH was employed to prepare 13CH3THF. B, representative mass spectra of CH2THF and CH3THF HPLC peaks. C, quantification of isotopically enriched THF analogs obtained as shown in (A) by HPLC-HRMS. See for details on quantification. The error bars represent an average of two technical replicates for the folate solution used in the assays in panel (D). D, mass spectra of the cmnm5s2U nucleoside observed when various isotopically enriched THF analogs are used in vitro reconstitution of MnmEG activity. All of the samples contained GTP, NADH, and glycine. HRMS, high resolution mass spectrometry; SHMT, serine hydroxymethyltransferase; THF, tetrahydrofolate.
      The THF analogs were quantitated using the HPLC-HRMS analysis. The CH2THF isotopologs prepared by SHMT contain mostly (98%–99%) the desired CH2THF derivative (Fig. 4C). However, the subsequent reduction to obtain CH3THF yielded varying amounts of 13CH3THF and 13CH2THF, depending on the nature of the reducing equivalent (see Fig. 4C). While reduction with NaCNBH3 converts the 13CH2THF to 13CH3THF quantitatively (∼99.5% conversion), reduction with MTHFR and NADH yields a mixture of labeled 13CH2THF and 13CH3THF in a ratio of 82:12. In all cases, the reaction mixtures were filtered through a 10 KDa molecular weight cut off (MWCO) filter to remove the protein, and the resulting THF analogs were directly used in reactions with MnmEG without any further purification.
      The mass spectra cmnm5s2U nucleoside formed upon incubation of the CH2THF isotopologs synthesized as described previously with MnmEG are shown in Figure 4D. As shown previously (see Fig. 2B), incubation with unlabeled folate yields a nucleoside product with an m/z of 348.08. By contrast, when 13CH2THF methylene is utilized, a nucleoside product with a +1 amu shift in mass forms (m/z = 349.09) (Fig. 4D). By analogy, using CD2THF led to a product with a +2 amu shift in mass to exhibit an m/z of 350.10, consistent with the incorporation of two deuteriums into the nucleoside product. A small amount of unlabeled product (m/z 348.08) is also observed, presumably from endogenously bound CH2THF or small amounts of unenriched CH2THF present in the input folate sample. To rule out CH3THF, however, we also carried out the same experiments with 13CH3THF prepared by NaCNBH3 reduction, where an unlabeled product with m/z of 348.08 is observed (compare Figs. 4D and 2B). We note that the minor enrichment of the 349.09 peaks can be attributed to the ∼0.5% amounts of CH2THF that remains after the reduction. When the 13CH3THF prepared by MTHFR/NADH is used, most of the product obtained is enriched (m/z = 349.09). This results from the significant quantities of 13CH2THF that remain after the enzymatic treatment. Collectively, these data unambiguously establish that the source of the carbon atom in cmnm5s2U is CH2THF.

      Formation of cmnm5s2U by MnmEG requires reducing equivalents

      MnmG is a flavoenzyme, and it has been presumed that the formation of cmnm5s2U requires reducing equivalents (
      • White D.J.
      • Merod R.
      • Thomasson B.
      • Hartzell P.L.
      GidA is an FAD-binding protein involved in development of Myxococcus xanthus.
      ,
      • Meyer S.
      • Scrima A.
      • Versées W.
      • Wittinghofer A.
      Crystal structures of the conserved tRNA-modifying enzyme GidA: implications for its interaction with MnmE and substrate.
      ). However, the role of the reductant in tRNA modification reaction is not known (
      • Armengod M.E.
      • Moukadiri I.
      • Prado S.
      • Ruiz-Partida R.
      • Benítez-Páez A.
      • Villarroya M.
      • et al.
      Enzymology of tRNA modification in the bacterial MnmEG pathway.
      ,
      • Moukadiri I.
      • Prado S.
      • Piera J.
      • Velázquez-campoy A.
      • Björk G.R.
      • Armengod M.E.
      Evolutionarily conserved proteins MnmE and GidA catalyze the formation of two methyluridine derivatives at tRNA wobble positions.
      ). In the studies shown in Figure 3, we observed, curiously, that eliminating exogenously supplied FAD and NADH from the reaction mixtures does not eliminate the formation of cmnm5s2U. The result with FAD can be justified because the enzyme already has some bound FAD, and one can rationalize that it is present in sufficient quantities for a significant fraction of MnmG to be catalytically active. Therefore, we sought to probe the requirement more directly for a reductant.
      Our preparations of MnmEG and all studies on the proteins that have been published to date are carried out in the presence of DTT (
      • Moukadiri I.
      • Prado S.
      • Piera J.
      • Velázquez-campoy A.
      • Björk G.R.
      • Armengod M.E.
      Evolutionarily conserved proteins MnmE and GidA catalyze the formation of two methyluridine derivatives at tRNA wobble positions.
      ,
      • Scrima A.
      • Vetter I.R.
      • Armengod M.E.
      • Wittinghofer A.
      The structure of the TrmE GTP-binding protein and its implications for tRNA modification.
      ,
      • Meyer S.
      • Scrima A.
      • Versées W.
      • Wittinghofer A.
      Crystal structures of the conserved tRNA-modifying enzyme GidA: implications for its interaction with MnmE and substrate.
      ). Therefore, the NADH paradox may be because there is enough DTT in the reaction mixtures to substitute when NADH is absent. Therefore, to probe the role of DTT, it was omitted from purification buffers and NADH or DTT were supplied exogenously. The UV-visible spectra depicted in Figure 5A show that when DTT-free MnmEG is incubated with NADH under anaerobic conditions, the endogenous flavin turns colorless within 20 min of incubation, as evidenced by the bleaching of the 450 nm peak (blue trace). A similar observation is also made within 90 min when DTT-free MnmEG proteins are incubated with exogenously supplied DTT (green trace). By contrast, when a reductant is absent, the bound flavin remains oxidized (red trace). Not surprisingly, we also observed free flavin reduction by DTT in the solution overnight under anaerobic conditions (Fig. S7). The exact nature of bound flavin reduction by DTT is not further explored. However, these observations clearly show that the flavin cofactor is likely reduced under the conditions that the assays are generally conducted with MnmEG.
      Figure thumbnail gr5
      Figure 5Role of reductant in the MnmEG reaction. A, UV-visible spectrum showing the loss of characteristic 450 nm absorbance by endogenously bound FAD in DTT-free MnmEG complex after incubation with exogenously supplied reducing agent under anaerobic conditions. On the contrary, endogenously bound FAD remains oxidized in the MnmEG only containing sample (green trace). Approximately 200 μM protein solutions were incubated with either 200 μM NADH or 1 mM DTT. B, the mass spectra of cmnm5s2U nucleoside showing product formation or absence when either FAD, NADH, and DTT are removed individually or in combination. The included or removed reagents are labeled for each trace. The y-axis is scaled similarly for all the spectra to facilitate direct comparison.
      Next, we examined the formation of cmnm5s2U with MnmEG purified using DTT-free buffers in the presence and absence of exogenously supplied FAD and reducing equivalents in the form of DTT or NADH. α-13C-Glycine was used in these assays to show that any observed product forms in the reaction unambiguously. As shown in Figure 5B, when MnmEG is incubated with GTP, α-13C-glycine, tRNA, CH2THF, and FAD in the presence of NADH, a peak at m/z of 349.09 is observed, consistent with the formation of 13C-labeled cmnm5s2U, which has expected m/z of 349.09. Turnover is also observed in the absence of NADH but in the presence of DTT. However, in the absence of both NADH and DTT, only a trace amount of 13C-labeled cmnm5s2U is observed. We could not eliminate the possibility that small amounts of the purified protein are reduced in vivo and remain reduced during the purification or that a small fraction is photo reduced during the assays. Further, the data show that the exogenous FAD is dispensable for the formation of cmnm5s2U, as the modification occurs if NADH is present. Finally, no product forms without NADH, DTT, and exogenously supplied FAD. These observations clearly show that the formation of cmnm5s2U requires the presence of a reducing equivalent, provided in vivo by NADH, but can be bypassed in vitro by DTT. Moreover, exogenous FAD is not necessary, and the bound MnmG is sufficient to support the reaction.

      Discussion

      The presence of cmnm5s2U and mnm5s2U hypermodified bases in E. coli tRNA was known (
      • Carbon J.
      • David H.
      • Studier M.H.
      Thiobases in escherichia coli transfer RNA: 2-thiocytosine and 5-methylaminomethyl-2-thiouracil.
      ,
      • Yamada Y.
      • Murao K.
      • Ishikura H.
      5-(Carboxymethylaminomethyl)-2-thiouridine, a new modified nucleoside found at the first letter position of the anticodon.
      ) long before their biosynthetic enzymes were identified and a role for them in base modification was established. For example, gidA, later renamed mnmG, was discovered in the context of encoding a protein that led to a glucose-inhibited cell division phenotype in bacteria (
      • Von Meyenburg K.
      • Jorgensen B.B.
      • Nielsen J.
      • Hansen F.G.
      OIG’G Promoters of the atp operon coding for the membrane-bound ATP synthase by Tn 10 insertion mutations of Escherichia cob" mapped.
      ). However, a study examining the frameshifting of GA repeats in E. coli using a β-galactosidase reporter assay led to the isolation of variants lacking mnmE or mnmG, establishing a potential link between these proteins and translation (
      • Brégeon D.
      • Colot V.
      • Radman M.
      • Taddei F.
      Translational misreading: a tRNA modification counteracts a +2 ribosomal frameshift.
      ). A similar inference was also made in another study examining E. coli variants deficient in the synthesis of mnm5s2U, which led to the recognition that the strains lack either mnmE or mnmG (
      • Elseviers D.
      • Petrullo L.A.
      • Gallagher P.J.
      Novel E. coli mutants deficient in blosynthesis of 5-methylamlnomethyl-2-thiouridine.
      ). Contemporaneously, genes encoding for MnmA and MnmC were already known and characterized to some extent, leading to the hypothesis that MnmE and MnmG, along with MnmA, collectively constitute the pathway to cmnm5s2U (
      • Brégeon D.
      • Colot V.
      • Radman M.
      • Taddei F.
      Translational misreading: a tRNA modification counteracts a +2 ribosomal frameshift.
      ).
      In the early 2000s, biochemical and structural studies on MnmE and MnmG established them as a GTPase and flavoenzyme, respectively (
      • Scrima A.
      • Vetter I.R.
      • Armengod M.E.
      • Wittinghofer A.
      The structure of the TrmE GTP-binding protein and its implications for tRNA modification.
      ,
      • Shi R.
      • Villarroya M.
      • Ruiz-Partida R.
      • Li Y.
      • Proteau A.
      • Prado S.
      • et al.
      Structure-function analysis of Escherichia coli MnmG (GidA), a highly conserved tRNA-modifying enzyme.
      ,
      • White D.J.
      • Merod R.
      • Thomasson B.
      • Hartzell P.L.
      GidA is an FAD-binding protein involved in development of Myxococcus xanthus.
      ,
      • Meyer S.
      • Wittinghofer A.
      • Versées W.
      G-domain dimerization orchestrates the tRNA wobble modification reaction in the MnmE/GidA complex.
      ,
      • Monleón D.
      • Martínez-Vicente M.
      • Esteve V.
      • Yim L.
      • Prado S.
      • Armengod M.E.
      • et al.
      Structural insights into the GTPase domain of Escherichia coli MnmE protein.
      ,
      • Meyer S.
      • Scrima A.
      • Versées W.
      • Wittinghofer A.
      Crystal structures of the conserved tRNA-modifying enzyme GidA: implications for its interaction with MnmE and substrate.
      ,
      • Osawa T.
      • Ito K.
      • Inanaga H.
      • Nureki O.
      • Tomita K.
      • Numata T.
      Conserved cysteine residues of GidA are essential for biogenesis of 5-Carboxymethylaminomethyluridine at tRNA anticodon.
      ). However, the in vitro reconstitution of the modification has proven challenging. MnmE, for example, can bind virtually all proffered THF analogs, including THF that carries no one carbon unit (
      • Moukadiri I.
      • Prado S.
      • Piera J.
      • Velázquez-campoy A.
      • Björk G.R.
      • Armengod M.E.
      Evolutionarily conserved proteins MnmE and GidA catalyze the formation of two methyluridine derivatives at tRNA wobble positions.
      ). Though levels of hypomodified bases that accumulate in strains lacking folate pathway enzymes suggest that CH2THF is the substrate (
      • Moukadiri I.
      • Prado S.
      • Piera J.
      • Velázquez-campoy A.
      • Björk G.R.
      • Armengod M.E.
      Evolutionarily conserved proteins MnmE and GidA catalyze the formation of two methyluridine derivatives at tRNA wobble positions.
      ,
      • Waller J.C.
      • Alvarez S.
      • Naponelli V.
      • Lara-Nuñez A.
      • Blaby I.K.
      • Da Silva V.
      • et al.
      A role for tetrahydrofolates in the metabolism of iron-sulfur clusters in all domains of life.
      ,
      • Morscher R.J.
      • Ducker G.S.
      • Li S.H.J.
      • Mayer J.A.
      • Gitai Z.
      • Sperl W.
      • et al.
      Mitochondrial translation requires folate-dependent tRNA methylation.
      ), this has never been demonstrated directly. Moreover, the molecular imperatives for cofactors, FAD and NADH, or the precise role of GTP and the exact nature of the reaction mechanism remained elusive. It has, for example, been challenging to understand why modification would sometimes require reductant (in the presence of low FAD concentrations) and at other times proceeded without the need for reductant (at high FAD concentrations) (
      • Moukadiri I.
      • Prado S.
      • Piera J.
      • Velázquez-campoy A.
      • Björk G.R.
      • Armengod M.E.
      Evolutionarily conserved proteins MnmE and GidA catalyze the formation of two methyluridine derivatives at tRNA wobble positions.
      ).
      The results in this article resolve these long-standing questions on substrate and reductant requirements of MnmEG. The uncertainties in the literature likely result from the propensity of MnmE to copurify with a variety of THF analogs, including CH2THF. The reductant requirement ambiguities result from variable quantities of DTT present in all previously purified MnmEG proteins. Using isotopically enriched THF analogs, we show that CH2THF is the correct substrate for the enzyme reaction. Moreover, we also demonstrate that the reaction requires NADH, though DTT can substitute in its absence. These results suggest that a reduced flavin is the starting point of the reaction that mobilizes the methylene carbon of the CH2THF, appending it to the C-5 position of the uracil base in the pathway to cmnm.
      The requirement for CH2THF and NADH in modification of the C-5 position of uracil by MnmEG in a FAD-dependent manner is reminiscent of folate/FAD-dependent TrmFO, which catalyzes a similar reaction and installs a methyl group onto C5 of the uridine present at position 54 of tRNAs in Gram-positive bacteria (
      • Urbonavičius J.
      • Skouloubris S.
      • Myllykallio H.
      • Grosjean H.
      Identification of a novel gene encoding a flavin-dependent tRNA:m5U methyltransferase in bacteria - evolutionary implications.
      ). Unlike in MnmEG, where each of the MnmE and MnmG binds to CH2THF and FAD, respectively, TrmFO binds to both CH2THF and the flavin cofactor (
      • Hamdane D.
      • Argentini M.
      • Cornu D.
      • Myllykallio H.
      • Skouloubris S.
      • Hui-Bon-Hoa G.
      • et al.
      Insights into folate/FAD-dependent tRNA methyltransferase mechanism: role of two highly conserved cysteines in catalysis.
      ). CH2THF can exist as a iminium tautomer in solution as shown in Figure 6A. The proposed mechanism for the TrmFO involves the formation of the iminium species by covalent transfer of the methylene group from the CH2THF to the reduced flavin cofactor (
      • Hamdane D.
      • Argentini M.
      • Cornu D.
      • Myllykallio H.
      • Skouloubris S.
      • Hui-Bon-Hoa G.
      • et al.
      Insights into folate/FAD-dependent tRNA methyltransferase mechanism: role of two highly conserved cysteines in catalysis.
      ,
      • Bou-Nader C.
      • Cornu D.
      • Guerineau V.
      • Fogeron T.
      • Fontecave M.
      • Hamdane D.
      Enzyme activation with a synthetic catalytic co-enzyme intermediate: nucleotide methylation by flavoenzymes.
      ,
      • Hamdane D.
      • Bruch E.
      • Un S.
      • Field M.
      • Fontecave M.
      Activation of a unique flavin-dependent tRNA-methylating agent.
      ,
      • Hamdane D.
      • Argentini M.
      • Cornu D.
      • Golinelli-Pimpaneau B.
      • Fontecave M.
      FAD/folate-dependent tRNA methyltransferase: flavin as a new methyl-transfer agent.
      ) (Fig. 6B). Further, the uracil on the tRNA is activated by an active site Cys residue allowing it to attack the FAD[N5 = CH2]+, forming a crosslinked species, which is resolved by deprotonation at C-5. Hydride transfer from the reduced flavin cofactor to olefin leads to m5U (
      • Hamdane D.
      • Argentini M.
      • Cornu D.
      • Myllykallio H.
      • Skouloubris S.
      • Hui-Bon-Hoa G.
      • et al.
      Insights into folate/FAD-dependent tRNA methyltransferase mechanism: role of two highly conserved cysteines in catalysis.
      ,
      • Bou-Nader C.
      • Cornu D.
      • Guerineau V.
      • Fogeron T.
      • Fontecave M.
      • Hamdane D.
      Enzyme activation with a synthetic catalytic co-enzyme intermediate: nucleotide methylation by flavoenzymes.
      ,
      • Hamdane D.
      • Bruch E.
      • Un S.
      • Field M.
      • Fontecave M.
      Activation of a unique flavin-dependent tRNA-methylating agent.
      ,
      • Hamdane D.
      • Argentini M.
      • Cornu D.
      • Golinelli-Pimpaneau B.
      • Fontecave M.
      FAD/folate-dependent tRNA methyltransferase: flavin as a new methyl-transfer agent.
      ).
      Figure thumbnail gr6
      Figure 6Schematic comparing the mechanisms of Bacillus subtilis (Bs) TrmFO and E. coli (Ec) MnmG. A, resonance structures of the CH2THF. B, proposed mechanism of TrmFO in the literature where the reduced flavin accepts CH2 group from the CH2THF and transfers it to the C-5 of the uracil. A similar mechanistic pathway could be proposed for the EcMnmEG reaction. In TrmFO, a hydride transfer from the FADH leads to formation of the m5U (blue dashed line box), whereas in MnmEG, nucleophilic attack by the glycine leads to the final product (red dashed line box). Both proteins utilize NADH to generate a reduced flavin cofactor and CH2THF as the carbon source at the C5 of the uracil. THF, tetrahydrofolate.
      TrmFO and MnmG both belong to the Gid class of proteins. MnmG clusters with the GidAL subclass in which the representative proteins are ∼600 aa long. By contrast, TrmFO is in the GidAs subclass, which is generally shorter (∼450 aa) (
      • Urbonavicius J.
      • Brochier-Armanet C.
      • Skouloubris S.
      • Myllykallio H.
      • Grosjean H.
      In Vitro detection of the enzymatic activity of folate-dependent tRNA (Uracil-54,-C5)-methyltransferase: evolutionary implications.
      ). By analogy to TrmFO, a mechanistic proposal for the MnmEG reaction based on the substrate's identity, reducing equivalent requirement, and conserving Cys residue is shown in Figure 6B. We propose that MnmEG catalyzes cmnm5 installation by employing a reduced flavin as a way station for the one-carbon from CH2THF to the base. However, the final step in the MnmEG reaction entails trapping the olefin by the amino group of glycine in contrast to hydride transfer from reduced flavin in the TrmFO reaction (
      • Lee Y.J.
      • Dai N.
      • Müller S.I.
      • Guan C.
      • Parker M.J.
      • Fraser M.E.
      • et al.
      Pathways of thymidine hypermodification.
      ). Further, in mammalian MnmEG homologs, taurine substitutes for glycine (
      • Suzuki T.
      • Suzuki T.
      • Wada T.
      • Saigo K.
      • Watanabe K.
      Taurine as a constituent of mitochondrial tRNAs: new insights into the functions of taurine and human mitochondrial diseases.
      ).
      Besides tRNA modification, MnmG is also involved in other regulatory pathways. The gene encoding for MnmG is also potentially involved in regulating the pathogenicity and virulence of certain microbes. Specifically, a gidA mutant of the pathogen Salmonella enterica serovar Typhimurium displayed high attenuation in a Salmonella infection mouse model (
      • Shippy D.C.
      • Eakley N.M.
      • Bochsler P.N.
      • Fadl A.A.
      Biological and virulence characteristics of Salmonella enterica serovar typhimurium following deletion of glucose-inhibited division (gidA) gene.
      ,
      • Shippy D.C.
      • Eakley N.M.
      • Lauhon C.T.
      • Bochsler P.N.
      • Fadl A.A.
      Virulence characteristics of Salmonella following deletion of genes encoding the tRNA modification enzymes GidA and MnmE.
      ). Additionally, Salmonella gidA strain exhibits downregulation of important virulence factors and alteration in several stress response genes for cold shock, heat shock, and nutrition deprivation compared to the WT (
      • Shippy D.C.
      • Eakley N.M.
      • Bochsler P.N.
      • Fadl A.A.
      Biological and virulence characteristics of Salmonella enterica serovar typhimurium following deletion of glucose-inhibited division (gidA) gene.
      ,
      • Shippy D.C.
      • Eakley N.M.
      • Lauhon C.T.
      • Bochsler P.N.
      • Fadl A.A.
      Virulence characteristics of Salmonella following deletion of genes encoding the tRNA modification enzymes GidA and MnmE.
      ). To amplify their importance, the proteins MnmE and MnmG have been included in the list of a minimal set of proteins required to have a functional translational apparatus in bacteria (
      • Grosjean H.
      • Breton M.
      • Sirand-Pugnet P.
      • Tardy F.
      • Thiaucourt F.
      • Citti C.
      • et al.
      Predicting the minimal translation apparatus: lessons from the reductive evolution of mollicutes.
      ,
      • McCutcheon J.P.
      • Moran N.A.
      Extreme genome reduction in symbiotic bacteria.
      ). The discovery in this article of the substrate and reductant requirements of MnmEG pave the way for detailed mechanistic studies of this RNA modification system as a potential target of therapeutic interventions.

      Experimental procedures

      Cloning of the mnmE, mnmG, glyA, and metF

      The mnmE and mnmG gene nucleotide sequences were PCR amplified from the ΔqueA E. coli (from Keio collection (
      • Baba T.
      • Ara T.
      • Hasegawa M.
      • Takai Y.
      • Okumura Y.
      • Baba M.
      • et al.
      Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.
      ), E. coli K-12 substrain) genomic DNA using Phusion High-Fidelity DNA polymerase (New England Biolabs) following the manufacturer's instructions. An annealing temperature of 68 °C was used based on the primer sequences designed for the PCR amplification. The forward and reverse primers used for mnmE PCR amplification were 5′- AAAAAAAACATATGAGCGATAATGACACTATCG-3′ and 5′- AAAAAAAAAAGCTTTTACTTACCAATACAGAAGCTGGAG-3′, respectively, with italicized sequence representing NdeI and HindIII restriction cut sites. The PCR products were digested with Ndel and HindIII and ligated with T4 DNA ligase into similarly digested and alkaline phosphatase treated pET29a vector to obtain pAY756 used in the expression of MnmE in E. coli. The plasmid to express MnmG was prepared the same as aforementioned, except the forward and reverse primers were 5′-AAAAAAAACATATGTTTTATCCGGATCCTTTTGACGTCATCATC-3′ and 5′-AAAAAAAACTCGAGTTATGCGCTACGACGCAGCATACCC-3′, respectively, with italicized sequence representing NdeI and XhoI restriction cut sites. The resulting expression plasmid was named pAY760 and used to prepare MnmG.
      The glyA and metF genes for SHMT and MTHFR enzymes were cloned from the Δtgt E. coli (from Keio collection, E. coli K-12 substrain) genomic DNA using Phusion High-Fidelity DNA polymerase (New England Biolabs) following the manufacturer's instructions. An annealing temperature of 66 °C was used for both the PCR amplifications. The forward and reverse primers used for glyA were 5′- AGAACCTGTACTTCCAGGGCCATATGTTAAAGCGTGAAATGAACATTGC-3′ and 5′- GGTGCTCGAGTGCGGCCGCAAGCTTTTATGCGTAAACCGGGTAACG-3′, respectively, with italicized sequences representing the NdeI and HindIII restriction cut sites. The forward and reverse primers used for metF were 5′-AGAACCTGTACTTCCAGGGCCATATGAGCTTTTTTCACGCCAGC and 5′-GGTGCTCGAGTGCGGCCGCAAGCTTTTATAAACCAGGTCGAACCCCC-3′, respectively, with italicized sequences similarly representing the NdeI and HindIII restriction cut sites. The PCR products were incorporated into the pET28t vector in a single step using the NEBuilder HiFi DNA assembly cloning kit following the manufacturer's instructions. The pET28t plasmid contains an N-terminal His-tag followed by a Tobacco Etch Virus nuclear-inclusion-a endopeptidase (TEV) cleavage site fused to the protein (
      • Young A.P.
      • Bandarian V.
      TYW1: a radical SAM enzyme involved in the biosynthesis of wybutosine bases.
      • Thoden J.B.
      • Holden H.M.
      The molecular architecture of human N-acetylgalactosamine kinase.
      ).

      Production of MnmE, MnmG, SHMT, and MTHFR proteins

      MnmE, MnmG, SHMT, and MTHFR plasmids are all transformed into E. coli BL21-DE3 phage T1 resistant electrocompetent E. coli cells (New England Biolabs) and inoculated onto Lennox broth (LB) agar plates containing kanamycin (34 μg/ml). The plates were incubated at 37 °C overnight to allow for the growth of the colonies. A single colony was picked from each plate and inoculated into ∼120 to 130 ml LB media and subsequently grown at 37 °C overnight by shaking at 200 rpm.
      Large scale expression was carried out in 6 to 12 2.8 l Fernbach flasks containing 1 l of LB media. An aliquot of the overnight cultured bacteria (10 ml) was added to each flask containing media and kanamycin (34 μg/ml). The cells were grown at 37 °C by shaking at 175 to 200 rpm until the A600 of the culture reached ∼0.5 to 0.6, at which point the cells were induced by the addition of IPTG to a final concentration of 100 μM. Flasks containing the bacteria expressing the MnmG were further supplemented with solid riboflavin (∼50 mg/l) after the IPTG induction to support the overexpression of the flavoprotein. The induced cells were shaken at 150 to 175 rpm overnight (∼12–16 h) at 37 °C (for MnmE and MnmG) or 18 °C (for SHMT or MTHFR). The cells were harvested by centrifugation at 5000g for 10 min, flash frozen in liquid nitrogen, and stored at –80 °C until further use.

      Purification of the proteins MnmE and MnmG

      The cells obtained from 12 l of media with cells expressing either MnmE or MnmG were resuspended in ∼150 ml of 20 mM Tris–HCl pH 8.0, 2 mM DTT, and 1 mM PMSF to inhibit proteases. The resuspended cells were lysed in the cold room at 4 °C or on ice by a sonicator with 50% amplitude, 15 s pulses, and 30 s rest to allow temperature re-equilibration. The cell lysate was clarified by centrifugation at 18,000g for 60 min at 4 °C and loaded onto a 40 ml Q Sepharose FF column (2.6 cm (D) × 14.5 cm (H), resin from GE healthcare) pre-equilibrated in buffer containing 20 mM Tris–HCl pH 8.0 and 2 mM DTT. After loading the lysate, the column was washed with the same buffer until the absorbance returned to the baseline, at which point the protein was eluted by a linear gradient from 0% to 100% 1 M KCl in a buffer containing 20 mM Tris–HCl pH 8.0 and 2 mM DTT over 5 to 10 column volumes. Fractions containing the protein of interest were identified by SDS-PAGE analysis, pooled, and then purified further as described later.
      To the protein eluted from the anion exchange column, solid ammonium sulfate was added directly while stirring in the cold room at 4 °C to a final concentration of 1 M. The small amount of protein precipitated during this step was removed by centrifugation at 18,000g for 20 min at 4 °C. The clarified protein solution was loaded onto a butyl Sepharose FF column (2.6 (D) × 14.5 (H) cm, resin from GE healthcare) pre-equilibrated in the loading buffer containing 20 mM Tris–HCl pH 8.0, 1 M (NH4)2SO4, and 2 mM DTT. After loading, the column was washed until the absorbance returned to the baseline. At this point, the protein was eluted with a gradient of the loading buffer without ammonium sulfate. The protein of interest was identified by SDS-PAGE analysis. The pooled fractions were dialyzed against 4 l of buffer containing 20 mM Tris–HCl pH 8.0, 2 mM DTT, and 5 % glycerol. The dialysis buffer was changed thrice, and the dialyzed protein was then concentrated using Amicon with an MWCO filter of (30 kDa). DTT-free MnmE and MnmG were prepared by purifying the proteins similarly as described before, although DTT was omitted from the purification buffers except for the buffer in which cells were resuspended and lysed. A representative SDS-PAGE analysis of MnmE and MnmG purified proteins is shown in Fig. S4A. The concentrated proteins were flash-frozen in aliquots, and the concentration was determined using the Bradford assay with bovine serum albumin as standard.

      Purification of the proteins SHMT and MTHFR

      The cells obtained from the overnight growth (for SHMT and MTHFR) were resuspended in ∼50 to 100 ml of buffer containing 50 mM potassium phosphate (KPi) pH 7.4, 500 mM KCl, 50 mM imidazole, and 1 mM PMSF. The resuspended cells were lysed using a sonicator with 15 s bursts at 50% followed by 30 s rest for temperature re-equilibration. The cell lysate was clarified by centrifugation at 18,000g for 60 min at 4 °C and loaded onto two serially connected 5 ml HisTrap FF (Cytiva) columns charged with Ni2+ and pre-equilibrated with a buffer containing 50 mM KPi pH 7.4, 500 mM KCl, and 50 mM imidazole. The column was washed with the loading buffer until the absorbance reached baseline. The proteins were eluted with a gradient to 500 mM imidazole in the loading buffer over 60 ml. The desired protein fractions were pooled and dialyzed against a buffer containing 50 mM Hepes-NaOH pH 8.0, 150 mM KCl, and 2 mM DTT. After SDS-PAGE analysis, SHMT seemed sufficiently pure and therefore was concentrated, frozen, and stored until use. The MTHFR from the first step was further purified by treating it with TEV protease (
      • Young A.P.
      • Bandarian V.
      TYW1: a radical SAM enzyme involved in the biosynthesis of wybutosine bases.
      ,
      • Thoden J.B.
      • Holden H.M.
      The molecular architecture of human N-acetylgalactosamine kinase.
      ) to remove the N-term His6-tag on the protein. The reaction was carried out in the dialysis bag overnight in the cold room at 4 °C. The resultant solution was loaded onto two serially connected 5 ml HisTrap FF (Cytiva) columns charged with Ni2+ and pre-equilibrated with a buffer containing 50 mM KPi pH 7.4, 500 mM KCl, and 50 mM imidazole. The fractions of interest were identified by SDS-PAGE analysis, pooled, and dialyzed overnight against a buffer containing 50 mM Hepes-NaOH pH 8.0, 150 mM KCl, and 2 mM DTT. The dialyzed protein was then concentrated, flash frozen, and stored at −80 °C until further use. The concentrations of the proteins were determined using the Bradford assay with bovine serum albumin as standard. A representative SDS-PAGE analysis of SHMT and MTHFR preparations is shown in Fig. S4A.

      Purification of total tRNA from ΔmnmE E. coli

      The hypomodified tRNA substrate containing s2U at the wobble uridines was obtained from the E. coli ΔmnmE deletion strain (from the Keio Collection (
      • Baba T.
      • Ara T.
      • Hasegawa M.
      • Takai Y.
      • Okumura Y.
      • Baba M.
      • et al.
      Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.
      )). LB culture media containing 34 μg/ml kanamycin (∼120–130 ml) were inoculated with the strain and grown overnight (12–16 h) at 37 °C and shaking speed of 200 rpm. An aliquot (10 ml) of the overnight culture was introduced into each of the six 2.8 l Fernbach flasks containing 1 l of LB media with 34 μg/ml kanamycin. The cultures were allowed to grow overnight at 37 °C by shaking at 200 rpm. The cells were pelleted by centrifugation at 5000g for 10 min at 4 °C. The resultant cells were flash frozen until further use. RNase-free water was used where applicable to avoid tRNA degradation during the preparation. The RNase-free water is prepared by treating the Millipore filtered water with 1 ml diethylpyrocarbonate per liter of the water to inactivate the RNases, followed by sterilization by autoclave to hydrolyze the remaining diethylpyrocarbonate.
      The RNA extraction is carried out essentially as described before but with modifications to the purification of the extracted RNA (
      • Young A.P.
      • Bandarian V.
      TYW1: a radical SAM enzyme involved in the biosynthesis of wybutosine bases.
      ). The cells were resuspended in a buffer containing 10 mM Tris–HCl pH 8.0, 10 mM MgCl2, and 150 mM NaCl (∼1 ml/1 mg of wet cell paste) by stirring in the cold room at 4 °C for 60 min. Next, saturated phenol (pH 4.3, 1 ml/1 mg of wet cell paste) was added to the resuspended cells and stirred for 60 min in the cold room at 4 °C. The resulting suspension was poured into RNase-free 50 ml conical tubes and centrifuged at 10,000g for 30 min at 4 °C. The upper aqueous layer was then transferred to fresh 50 ml conical tubes, and saturated phenol (pH 4.3, 1 ml/mg of starting wet cell paste) was added and mixed by inversion. The resulting suspension was centrifuged at 10,000g for an additional 30 min at 4 °C. The resulting upper aqueous layer was removed and mixed with 0.1 volumes of 3 M sodium acetate (pH 5.2) and three volumes of ice-cold ethanol. The resulting solution was incubated at –20 °C overnight to precipitate RNA. The RNA was pelleted by centrifugation at 15,000g for 30 min at 4 °C, the supernatant was discarded, and the pellet was resuspended in 1 M NaCl solution by vigorous vortex mixing. The undissolved precipitate was removed by centrifugation at 7000g for 30 min at 4 °C. The supernatant was collected and ethanol precipitated as described previously. Further purification of the tRNA was carried out on refrigerated AKTA fast protein liquid chromatography prime setup using an anion exchange column. The pump, super loop, and the lines were thoroughly washed with RNase-free water before purifying the RNA.
      The pellet from the second ethanol precipitation was dissolved in 40 to 50 ml of a buffer containing 20 mM sodium acetate (NaOAc) pH 5.2 and loaded onto a 50 ml DEAE Sepharose FF column (resin from Cytiva) pre-equilibrated with the same buffer. The column was then washed with a loading buffer containing 0.34 M NaCl until the absorbance returned to the baseline. At this point, the RNA was eluted with a gradient from 0.34 M to 0.52 M NaCl in a total of 875 ml. The fractions were analyzed via 10% denaturing PAGE analysis (TBE buffer system, see Fig. S4B for a representative RNA elution profile on the DEAE Sepharose column). The tRNA fractions were pooled and ethanol precipitated by mixing with three volumes of ice-cold ethanol and incubation at −20 °C overnight. The tRNA was pelleted by centrifugation at 10,000g for 60 min at 4 °C. The resulting precipitate was dried by vacuum to remove the ethanol, and the white powder was resuspended in 4 to 5 ml of a buffer containing 20 mM Tris pH 8.0 and 5 mM EDTA and stored in aliquots at −80 °C until further use.

      In vitro reconstitution of MnmEG reaction

      All reactions were carried out in a Coy glovebox chamber (∼97% N2, ∼3% H2) under anoxic conditions. The reaction solutions such as buffers (1 M Tris–HCl pH 8.0), salt solutions (500 mM MgCl2 and 1 M KCl), and RNase-free water were stirred in the glovebox for a minimum of 24 h to limit the amount of oxygen in the reactions. All the reagent stock solutions such as CH2THF and CH3THF (Schircks laboratories), FAD, NADH, GTP, glycine, and DTT were prepared inside the glovebox in 50 mM Tris–HCl pH 8.0. The concentrations of these samples were determined using UV-visible spectrophotometry (Agilent 8453) using the extinction coefficient at 294 nm of 25,000 M−1 cm−1 and 32,000 M−1 cm−1 for CH2THF and CH3THF, respectively. When applicable, accurate concentrations of FAD and NADH are calculated prior to reaction assays using UV-visible absorption coefficients of 11,300 M−1 cm−1 at 450 nm and 6220 M−1 cm−1 at 340 nm, respectively. The stock solutions were dispensed into small aliquots, flash frozen, and stored at −80 °C until use.
      In the reconstitution experiments, MnmE and MnmG were preincubated in 100 mM Tris–HCl pH 8.0, 100 to 150 mM KCl, and 5 % glycerol for 30 min. The typical assay mixture contained of 50 mM Tris–HCl, 5 mM MgCl2, 100 mM KCl, 0.5 mM exogenous unlabeled folate, 0.5 mM FAD, 0.5 mM NADH, 2 mM glycine (either unlabeled or α-13C labeled), 2 mM GTP, 60 to 100 ug of purified tRNA, and ∼3% to 5% glycerol per 100 μl of the reaction mixtures. The reactions were initiated by adding the preincubated MnmEG to a final concentration of 2 μM. DTT (2 mM) was included as indicated. In assays carried out with DTT-free protein preparations, the concentrations of the MnmEG were maintained at ∼10 to 20 μM. All the reaction mixtures were allowed to incubate overnight (12–14 h) at 37 °C inside the glovebox.

      Reaction clean-up, digestion, and HPLC-HRMS analysis of tRNA nucleosides

      For the analysis of the tRNA nucleosides, 80 μl of the reaction was transferred to a fresh Eppendorf tube and removed from the glovebox. The tRNA was extracted from the reaction mixtures using Qiagen miRNeasy mini kit following the manufacturer's directions for the purification of RNA >18 nt as reported previously (
      • Bommisetti P.
      • Bandarian V.
      Site-specific profiling of 4-thiouridine across transfer RNA genes in Escherichia coli.
      ). RNA HiBind spin columns (Omega Biotek) were employed with Qiagen buffers. The eluted RNA from the mini columns was digested to nucleoside level using P1 nuclease (New England Biolabs), phosphodiesterase, and Fast AP (Thermo Fisher Scientific), as reported previously (
      • Bommisetti P.
      • Bandarian V.
      Site-specific profiling of 4-thiouridine across transfer RNA genes in Escherichia coli.
      ). The enzymatic digestion reaction mixtures were filtered through a 10 KDa MWCO filter prior to loading onto a Hypersil Gold C-18 column (particle size – 1.9 μM, dimensions – 2.1 mm (D) × 150 mm (L), Thermo Fisher) connected to a Vanquish UHPLC instrument (Thermo Fisher Scientific) with a photodiode array detector and a Q-Exactive mass spectrometer. The column was pre-equilibrated in buffer A containing 50 mM (NH4)2OAc pH 5.3 in Optima water at a flow rate of 0.2 ml/min. The separation of nucleosides was carried out by applying a gradient of buffer B containing 40% (v/v) Optima grade acetonitrile in water. The gradient applied is as follows: time: 0 to 3.5 min, % B: 0 to 0.8; time 3.5 to 3.75 min, % B: 0.8 to 3.2; time: 3.75 to 4.0 min, % B: 3.2 to 5.0; time: 4 to 7 min, % B:5.0 to 25.0; time: 7 to 10 min, % B: 25 to 50; time: 10 to 12 min, % B: 50 to 75; time: 12 to 12.1 min, % B: 75 to 100; time: 12.1 to 15 min, % B: 100. The eluent from the column was directed to a Q-exactive mass spectrometer, and data are recorded with an FT analyzer in positive ion mode between m/z 150 to 800 at a resolution of 70,000. The instrument was maintained at a capillary temperature of 320 °C, with sheath gas flow 35, auxiliary gas flow 12, and a source voltage of 3 kV. The mass corresponding to the cmnm5s2U nucleoside was included in the inclusion list, and the detector was operated in SIM (isolation range ± 2 amu) mode at a resolution of 70,000 between 3 to 7 min.

      HPLC-HRMS analysis of FAD and THF derivatives

      The reaction mixtures or the concentrated protein solutions were treated with 30% w/v TCA to a final concentration of ∼5% to 10% of TCA and allowed to denature for 10 min at room temperature (RT), followed by centrifugation at 21,000g for 15 min to pellet out the precipitate. The supernatant was collected and injected onto a Hypersil Gold C-18 column (particle size – 1.9 μM, dimensions – 2.1 mm (D) × 150 mm (L), Thermo Fisher) connected to a Vanquish UHPLC instrument (Thermo Fisher Scientific) with a photodiode array detector and a Q-Exactive mass spectrometer. The column was pre-equilibrated in buffer A containing 0.1 % TFA in optima water at a flow rate of 0.2 ml/min, and separation was carried out by applying a gradient of buffer B containing 0.1 % TFA in optima acetonitrile. The gradient applied is as follows: time: 0 to 3 min, % B:0; time: 3 to 6 min, % B:0 to 20; time:6 to 9 min, % B:20 to 42; time: 9 to 15 min, % B: 42 to 48; time: 15 to 18 min, % B: 48 to 75; time:18 to 21 min, % B: 75 to 100. The same gradient was employed for separation and analysis of the THF analogs and FAD. Photodiode array detection is carried out between 190 to 650 nm wavelengths.
      The eluent from the column was analyzed using a Q-Exactive mass spectrometer as described previously, except that the m/z 250 to 1300 range was used at a resolution of 140,000. The masses corresponding to FAD or R-THF molecules were included in the inclusion list, and the detector was operated in SIM mode (isolation range ± 2 amu) between 7 to 10 min and between 9 to 11 min for R-THF and FAD, respectively. A standard curve with authentic FAD was used to quantify the FAD that copurifies with MnmG using the area under 450 nm peak.

      UV-visible spectrophotometric analysis of MnmG

      The UV-visible spectrophotometry analysis of intact MnmG, TCA precipitated MnmG supernatant, and authentic FAD was recorded on an Agilent 8454 instrument with a photodiode array detector under aerobic conditions between the wavelength range 190 to 800 nm. Aerobic conditions allow for oxidation of flavin cofactor for accurate quantification of the flavin. An aliquot (∼150 μM) of the MnmG solution was used, and the supernatant of the sample denatured with 30% w/v TCA was used in the analysis.
      UV-visible analysis of the MnmEG complex to probe the role of a reductant is carried out on an Agilent 8453 instrument located in the Coy glovebox chamber (97.5% N2 and 2.5 % H2) under anaerobic conditions to minimize any reoxidation of the protein. An aliquot (∼200 μM) of DTT-free MnmEG was mixed with 200 μM of NADH or 1 mM DTT and allowed to incubate for 90 min at RT inside the glovebox. A blank without the reducing agent is included as well.

      Chemoenzymatic synthesis of labeled THF derivatives and concentration determination

      The isotopically labeled 13CH2THF was prepared by incubating SHMT, THF (MedChem express), pyridoxal phosphate, and β-13C-Serine or β-CD2-Serine (Cambridge Isotope Laboratories). The reaction mixture generally contained ∼190 μM SHMT, ∼350 to 500 μM THF, 2 mM 13C labeled or deuterium labeled serine, and 1 mM pyridoxal phosphate in 100 mM Tris–HCl pH 8.0 buffer. The reactions were incubated at 37 °C for 60 min under anaerobic conditions. The reaction mixture is filtered through the 10 KDa MWCO centrifugal filter to remove the enzyme, and the resulting THF was used in vitro reconstitution without further purification.
      In a separate preparation, after the incubation of the SHMT reaction for 60 min, the enzyme was filtered through MWCO centrifugal filter and mixed with MTHFR and NADH to prepare the isotopically labeled 13CH3THF. MTHFR and NADH were added to the filtrate to a concentration of ∼110 μM and ∼400 μM, respectively, in a total volume of 100 μl. In reactions employing NaCNBH3, the filtrate was mixed with 2 μl of saturated reductant (in acetonitrile) in a total volume of 100 μl. The reactions were carried out at 37 °C for 60 min under anaerobic conditions. The reaction mixtures were filtered using a 10 KDa MWCO filter, and the flow through was used in the in vitro reconstitution.
      The composition and concentrations of species present in the RTHF produced as described before were carried out by HPLC-HRMS. Standard curves were generated using the area under the molecular ion peaks of the commercially available unlabeled CH2THF and CH3THF samples. Technical replicates were employed for each sample analyzed. Adenosine nucleoside is used as the internal control to account for the differences in ionization between samples. The molecular ion peaks m/z 459.17 ± 0.01 and 460.19 ± 0.01 were considered for 13CH2THF and CD2THF, respectively, to determine the area of isotopically labeled RTHF peaks. Similarly, the molecular ion peak m/z – 461.19 ± 0.01 was considered for 13CH3THF.

      Data availability

      All data generated or analyzed during this study are included in this published article (and its supporting information files).

      Supporting information

      This article contains supporting information (
      • Moukadiri I.
      • Prado S.
      • Piera J.
      • Velázquez-campoy A.
      • Björk G.R.
      • Armengod M.E.
      Evolutionarily conserved proteins MnmE and GidA catalyze the formation of two methyluridine derivatives at tRNA wobble positions.
      ,
      • Waller J.C.
      • Alvarez S.
      • Naponelli V.
      • Lara-Nuñez A.
      • Blaby I.K.
      • Da Silva V.
      • et al.
      A role for tetrahydrofolates in the metabolism of iron-sulfur clusters in all domains of life.
      ).

      Conflict of interest

      The authors declare that they have no conflicts of interest with the contents of this article.

      Acknowledgments

      Sequencing was performed at the DNA Sequencing Core Facility of the University of Utah. The expression vector for TEV protease (prTEV) and the cell line used for the expression of TEV protease (SG13000009) was a gift from Professor Hazel Holden at the University of Wisconsin–Madison. The authors also acknowledge start-up funds from the University of Utah .

      Author contributions

      P. B. and V. B. conceptualization; P. B. methodology; P. B. formal analysis; A. Y. investigation; P. B. and V. B. writing–original draft; A. Y. and V. B. writing–review & editing; V. B. funding acquisition.

      Funding and additional information

      The research reported in this publication was supported by the National Institutes of General Medical Sciences of the National Institutes of Health (NIH) under the award number R35 GM126956. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

      Supporting information

      References

        • Boccaletto P.
        • MacHnicka M.A.
        • Purta E.
        • Pitkowski P.
        • Baginski B.
        • Wirecki T.K.
        • et al.
        MODOMICS: a database of RNA modification pathways. 2017 update.
        Nucleic Acids Res. 2018; 46: D303-D307
        • Björk G.R.
        • Hagervall T.G.
        Transfer RNA modification: presence, synthesis, and function.
        EcoSal Plus. 2014; 6https://doi.org/10.1128/ecosalplus.esp-0007-2013
        • Miles Z.D.
        • McCarty R.M.
        • Molnar G.
        • Bandarian V.
        Discovery of epoxyqueuosine (oQ) reductase reveals parallels between halorespiration and tRNA modification.
        Proc. Natl. Acad. Sci. U. S. A. 2011; 108: 7368-7372
        • McCarty R.M.
        • Somogyi Á.
        • Lin G.
        • Jacobsen N.E.
        • Bandarian V.
        The deazapurine biosynthetic pathway revealed: in vitro enzymatic synthesis of PreQ0 from guanosine 5′-triphosphate in four steps.
        Biochemistry. 2009; 48: 3847-3852
        • Okada N.
        • Nishimura S.
        Isolation and characterization of a guanine insertion enzyme, a specific tRNA transglycosylase, from Escherichia coli.
        J. Biol. Chem. 1979; 254: 3061-3066
        • Slany R.K.
        • Bösl M.
        • Crain P.F.
        • Kersten H.
        A new function of S-adenosylmethionine: the ribosyl moiety of AdoMet is the precursor of the cyclopentenediol moiety of the tRNA wobble base queuine.
        Biochemistry. 1993; 32: 7811-7817
        • Young A.P.
        • Bandarian V.
        Radical mediated ring formation in the biosynthesis of the hypermodified tRNA base wybutosine.
        Curr. Opin. Chem. Biol. 2013; 17: 613-618
        • Noma A.
        • Kirino Y.
        • Ikeuchi Y.
        • Suzuki T.
        Biosynthesis of wybutosine, a hyper-modified nucleoside in eukaryotic phenylalanine tRNA.
        EMBO J. 2006; 25: 2142-2154
        • Esberg B.
        • Leung H.C.E.
        • Tsui H.C.T.
        • Bjork G.R.
        • Winkler M.E.
        Identification of the miaB gene, involved in methylthiolation of isopentenylated A37 derivatives in the tRNA of Salmonella typhimurium and Escherichia coli.
        J. Bacteriol. 1999; 181: 7256-7265
        • Armengod M.E.
        • Meseguer S.
        • Villarroya M.
        • Prado S.
        • Moukadiri I.
        • Ruiz-Partida R.
        • et al.
        Modification of the wobble uridine in bacterial and mitochondrial tRNAs reading NNA/NNG triplets of 2-codon boxes.
        RNA Biol. 2014; 11: 1495-1507
        • Weixlbaumer A.
        • Murphy IV F.V.
        • Dziergowska A.
        • Malkiewicz A.
        • Vendeix F.A.P.
        • Agris P.F.
        • et al.
        Mechanism for expanding the decoding capacity of transfer RNAs by modification of uridines.
        Nat. Struct. Mol. Biol. 2007; 146: 498-502
        • Näsvall S.J.
        • Chen P.
        • Björk G.R.
        The modified wobble nucleoside uridine-5-oxyacetic acid in tRNAProcmo5UGG promotes reading of all four proline codons in vivo.
        RNA. 2004; 10: 1662-1673
        • Kirino Y.
        • Suzuki T.
        Human mitochondrial diseases associated with tRNA wobble modification deficiency.
        RNA Biol. 2005; 2: 41-44
        • Suzuki T.
        • Nagao A.
        • Suzuki T.
        Human mitochondrial trnas: biogenesis, function, structural aspects, and diseases.
        Annu. Rev. Genet. 2011; 45: 299-329
        • Kirino Y.
        • Yasukawa T.
        • Ohta S.
        • Akira S.
        • Ishihara K.
        • Watanabe K.
        • et al.
        Codon-specific translational defect caused by a wobble modification deficiency in mutant tRNA from a human mitochondrial disease.
        Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 15070-15075
        • Goto Y.I.
        • Nonaka I.
        • Horai S.
        A mutation in the tRNALeu(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies.
        Nature. 1990; 348: 651-653
        • Kobayashi Y.
        • Momoi M.Y.
        • Tominaga K.
        • Shimoizumi H.
        • Nihei K.
        • Yanagisawa M.
        • et al.
        Respiration-deficient cells are caused by a single point mutation in the mitochondrial tRNA-Leu (UUR) gene in mitochondrial myopathy, encephalopathy, lactic acidosis, and strokelike episodes (MELAS).
        Am. J. Hum. Genet. 1991; 49: 590-599
        • Shoffner J.M.
        • Lott M.T.
        • Lezza A.M.S.
        • Seibel P.
        • Ballinger S.W.
        • Wallace D.C.
        Myoclonic epilepsy and ragged-red fiber disease (MERRF) is associated with a mitochondrial DNA tRNALys mutation.
        Cell. 1990; 61: 931-937
        • Armengod M.E.
        • Moukadiri I.
        • Prado S.
        • Ruiz-Partida R.
        • Benítez-Páez A.
        • Villarroya M.
        • et al.
        Enzymology of tRNA modification in the bacterial MnmEG pathway.
        Biochimie. 2012; 94: 1510-1520
        • Moukadiri I.
        • Prado S.
        • Piera J.
        • Velázquez-campoy A.
        • Björk G.R.
        • Armengod M.E.
        Evolutionarily conserved proteins MnmE and GidA catalyze the formation of two methyluridine derivatives at tRNA wobble positions.
        Nucleic Acids Res. 2009; 37: 7177-7193
        • Brégeon D.
        • Colot V.
        • Radman M.
        • Taddei F.
        Translational misreading: a tRNA modification counteracts a +2 ribosomal frameshift.
        Genes Dev. 2001; 15: 2295-2306
        • Elseviers D.
        • Petrullo L.A.
        • Gallagher P.J.
        Novel E. coli mutants deficient in blosynthesis of 5-methylamlnomethyl-2-thiouridine.
        Nucleic Acids Res. 1984; 12: 3521-3534
        • Bujnicki J.M.
        • Oudjama Y.
        • Roovers M.
        • Owczarek S.
        • Caillet J.
        • Droogmans L.
        Identification of a bifunctional enzyme MnmC involved in the biosynthesis of a hypermodified uridine in the wobble position of tRNA.
        RNA. 2004; 10: 1236-1242
        • Hagervall T.G.
        • Björk G.R.
        Genetic mapping and cloning of the gene (trmC) responsible for the synthesis of tRNA (mnm5s2U)methyltransferase in Escherichia coli K12.
        Mol. Gen. Genet. 1984; 196: 201-207
        • Benítez-Páez A.
        • Villarroya M.
        • Douthwaite S.
        • Gabaldón T.
        • Armengod M.E.
        YibK is the 2′-O-methyltransferase TrmL that modifies the wobble nucleotide in Escherichia coli tRNALeu isoacceptors.
        RNA. 2010; 16: 2131-2143
        • Kambampati R.
        • Lauhon C.T.
        Mnma and IscS are required for in vitro 2-thiouridine biosynthesis in Escherichia coli.
        Biochemistry. 2003; 42: 1109-1117
        • Wittwer A.J.
        • Stadtman T.C.
        Biosynthesis of 5-methylaminomethyl-2-selenouridine, a naturally occurring nucleoside in Escherichia coli tRNA.
        Arch. Biochem. Biophys. 1986; 248: 540-550
        • Jäger G.
        • Chen P.
        • Björk G.R.
        Transfer RNA bound to MnmH protein is enriched with geranylated tRNA-A possible intermediate in its selenation?.
        PLoS One. 2016; 11e0153488
        • Szczupak P.
        • Sierant M.
        • Wielgus E.
        • Radzikowska-Cieciura E.
        • Kulik K.
        • Krakowiak A.
        • et al.
        Escherichia coli tRNA 2-selenouridine synthase (SelU): elucidation of substrate specificity to understand the role of S-geranyl-tRNA in the conversion of 2-Thio-into 2-selenouridines in bacterial tRNA.
        Cells. 2022; 11: 1522
        • Wang X.
        • Yan Q.
        • Guan M.X.
        Combination of the loss of cmnm5U34 with the lack of s2U34 modifications of tRNALys, tRNAGlu, and tRNAGln altered mitochondrial biogenesis and Respiration.
        J. Mol. Biol. 2010; 395: 1038-1048
        • Suzuki T.
        • Suzuki T.
        • Wada T.
        • Saigo K.
        • Watanabe K.
        Taurine as a constituent of mitochondrial tRNAs: new insights into the functions of taurine and human mitochondrial diseases.
        EMBO J. 2002; 21: 6581-6589
        • Scrima A.
        • Vetter I.R.
        • Armengod M.E.
        • Wittinghofer A.
        The structure of the TrmE GTP-binding protein and its implications for tRNA modification.
        EMBO J. 2005; 24: 23-33
        • Waller J.C.
        • Alvarez S.
        • Naponelli V.
        • Lara-Nuñez A.
        • Blaby I.K.
        • Da Silva V.
        • et al.
        A role for tetrahydrofolates in the metabolism of iron-sulfur clusters in all domains of life.
        Proc. Natl. Acad. Sci. U. S. A. 2010; 107: 10412-10417
        • Morscher R.J.
        • Ducker G.S.
        • Li S.H.J.
        • Mayer J.A.
        • Gitai Z.
        • Sperl W.
        • et al.
        Mitochondrial translation requires folate-dependent tRNA methylation.
        Nature. 2018; 554: 128-132
        • Shi R.
        • Villarroya M.
        • Ruiz-Partida R.
        • Li Y.
        • Proteau A.
        • Prado S.
        • et al.
        Structure-function analysis of Escherichia coli MnmG (GidA), a highly conserved tRNA-modifying enzyme.
        J. Bacteriol. 2009; 191: 7614-7619
        • White D.J.
        • Merod R.
        • Thomasson B.
        • Hartzell P.L.
        GidA is an FAD-binding protein involved in development of Myxococcus xanthus.
        Mol. Microbiol. 2001; 42: 503-517
        • Young A.P.
        • Bandarian V.
        TYW1: a radical SAM enzyme involved in the biosynthesis of wybutosine bases.
        Methods Enzymol. 2018; 606: 119-153
        • Bommisetti P.
        • Bandarian V.
        Site-specific profiling of 4-thiouridine across transfer RNA genes in Escherichia coli.
        ACS Omega. 2022; 7: 4011-4025
        • Meyer S.
        • Wittinghofer A.
        • Versées W.
        G-domain dimerization orchestrates the tRNA wobble modification reaction in the MnmE/GidA complex.
        J. Mol. Biol. 2009; 392: 910-922
        • Fislage M.
        • Brosens E.
        • Deyaert E.
        • Spilotros A.
        • Pardon E.
        • Loris R.
        • et al.
        SAXS analysis of the tRNA-modifying enzyme complex MnmE/MnmG reveals a novel interaction mode and GTP-induced oligomerization.
        Nucleic Acids Res. 2014; 42: 5978-5992
        • Monleón D.
        • Martínez-Vicente M.
        • Esteve V.
        • Yim L.
        • Prado S.
        • Armengod M.E.
        • et al.
        Structural insights into the GTPase domain of Escherichia coli MnmE protein.
        Proteins. 2007; 66: 726-739
        • Green J.M.
        • Matthews R.G.
        Folate biosynthesis, reduction, and Polyglutamylation and the interconversion of folate derivatives.
        EcoSal Plus. 2007; 2https://doi.org/10.1128/ecosalplus.3.6.3.6
        • Wang B.
        • Jorns M.S.
        Reconstitution of Escherichia coli DNA Photolyase with various folate derivatives.
        Biochemistry. 1989; 28: 1148-1152
        • Meyer S.
        • Scrima A.
        • Versées W.
        • Wittinghofer A.
        Crystal structures of the conserved tRNA-modifying enzyme GidA: implications for its interaction with MnmE and substrate.
        J. Mol. Biol. 2008; 380: 532-547
        • Carbon J.
        • David H.
        • Studier M.H.
        Thiobases in escherichia coli transfer RNA: 2-thiocytosine and 5-methylaminomethyl-2-thiouracil.
        Science. 1968; 161: 1146-1147
        • Yamada Y.
        • Murao K.
        • Ishikura H.
        5-(Carboxymethylaminomethyl)-2-thiouridine, a new modified nucleoside found at the first letter position of the anticodon.
        Nucleic Acids Res. 1981; 9: 1933-1939
        • Von Meyenburg K.
        • Jorgensen B.B.
        • Nielsen J.
        • Hansen F.G.
        OIG’G Promoters of the atp operon coding for the membrane-bound ATP synthase by Tn 10 insertion mutations of Escherichia cob" mapped.
        Mol. Gen. Genet. 1982; 188: 240-248
        • Osawa T.
        • Ito K.
        • Inanaga H.
        • Nureki O.
        • Tomita K.
        • Numata T.
        Conserved cysteine residues of GidA are essential for biogenesis of 5-Carboxymethylaminomethyluridine at tRNA anticodon.
        Structure. 2009; 17: 713-724
        • Urbonavičius J.
        • Skouloubris S.
        • Myllykallio H.
        • Grosjean H.
        Identification of a novel gene encoding a flavin-dependent tRNA:m5U methyltransferase in bacteria - evolutionary implications.
        Nucleic Acids Res. 2005; 33: 3955-3964
        • Hamdane D.
        • Argentini M.
        • Cornu D.
        • Myllykallio H.
        • Skouloubris S.
        • Hui-Bon-Hoa G.
        • et al.
        Insights into folate/FAD-dependent tRNA methyltransferase mechanism: role of two highly conserved cysteines in catalysis.
        J. Biol. Chem. 2011; 286: 36268-36280
        • Bou-Nader C.
        • Cornu D.
        • Guerineau V.
        • Fogeron T.
        • Fontecave M.
        • Hamdane D.
        Enzyme activation with a synthetic catalytic co-enzyme intermediate: nucleotide methylation by flavoenzymes.
        Angew Chem. Int. Ed. Engl. 2017; 129: 12697-12701
        • Hamdane D.
        • Bruch E.
        • Un S.
        • Field M.
        • Fontecave M.
        Activation of a unique flavin-dependent tRNA-methylating agent.
        Biochemistry. 2013; 52: 8949-8956
        • Hamdane D.
        • Argentini M.
        • Cornu D.
        • Golinelli-Pimpaneau B.
        • Fontecave M.
        FAD/folate-dependent tRNA methyltransferase: flavin as a new methyl-transfer agent.
        J. Am. Chem. Soc. 2012; 134: 19739-19745
        • Urbonavicius J.
        • Brochier-Armanet C.
        • Skouloubris S.
        • Myllykallio H.
        • Grosjean H.
        In Vitro detection of the enzymatic activity of folate-dependent tRNA (Uracil-54,-C5)-methyltransferase: evolutionary implications.
        Methods Enzymol. 2007; 425: 103-119
        • Lee Y.J.
        • Dai N.
        • Müller S.I.
        • Guan C.
        • Parker M.J.
        • Fraser M.E.
        • et al.
        Pathways of thymidine hypermodification.
        Nucleic Acids Res. 2022; 50: 3001-3017
        • Shippy D.C.
        • Eakley N.M.
        • Bochsler P.N.
        • Fadl A.A.
        Biological and virulence characteristics of Salmonella enterica serovar typhimurium following deletion of glucose-inhibited division (gidA) gene.
        Microb. Pathog. 2011; 50: 303-313
        • Shippy D.C.
        • Eakley N.M.
        • Lauhon C.T.
        • Bochsler P.N.
        • Fadl A.A.
        Virulence characteristics of Salmonella following deletion of genes encoding the tRNA modification enzymes GidA and MnmE.
        Microb. Pathog. 2013; 57: 1-9
        • Grosjean H.
        • Breton M.
        • Sirand-Pugnet P.
        • Tardy F.
        • Thiaucourt F.
        • Citti C.
        • et al.
        Predicting the minimal translation apparatus: lessons from the reductive evolution of mollicutes.
        PLoS Genet. 2014; 10e1004363
        • McCutcheon J.P.
        • Moran N.A.
        Extreme genome reduction in symbiotic bacteria.
        Nat. Rev. Microbiol. 2012; 10: 13-26
        • Baba T.
        • Ara T.
        • Hasegawa M.
        • Takai Y.
        • Okumura Y.
        • Baba M.
        • et al.
        Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.
        Mol. Syst. Biol. 2006; 22006.0008
        • Thoden J.B.
        • Holden H.M.
        The molecular architecture of human N-acetylgalactosamine kinase.
        J. Biol. Chem. 2005; 280: 32784-32791