Advertisement

Sequential hydrolysis of FAD by ecto-5′ nucleotidase CD73 and alkaline phosphatase is required for uptake of vitamin B2 into cells

  • Natsuki Shichinohe
    Affiliations
    Department of Food and Chemical Toxicology, School of Pharmaceutical Sciences, Health Sciences University of Hokkaido, Ishikari-Tobetsu, Hokkaido, Japan
    Search for articles by this author
  • Daisuke Kobayashi
    Correspondence
    For correspondence: Yoshiko Murakami; Daisuke Kobayashi
    Affiliations
    Department of Food and Chemical Toxicology, School of Pharmaceutical Sciences, Health Sciences University of Hokkaido, Ishikari-Tobetsu, Hokkaido, Japan
    Search for articles by this author
  • Ayaka Izumi
    Affiliations
    Department of Food and Chemical Toxicology, School of Pharmaceutical Sciences, Health Sciences University of Hokkaido, Ishikari-Tobetsu, Hokkaido, Japan
    Search for articles by this author
  • Kazuya Hatanaka
    Affiliations
    Department of Food and Chemical Toxicology, School of Pharmaceutical Sciences, Health Sciences University of Hokkaido, Ishikari-Tobetsu, Hokkaido, Japan
    Search for articles by this author
  • Rio Fujita
    Affiliations
    Department of Food and Chemical Toxicology, School of Pharmaceutical Sciences, Health Sciences University of Hokkaido, Ishikari-Tobetsu, Hokkaido, Japan
    Search for articles by this author
  • Taroh Kinoshita
    Affiliations
    Laboratory of Immunoglycobiology, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka, Japan

    WPI Immunology Frontier Research Center, Osaka University, Suita, Osaka, Japan

    Center for Infectious Disease Education and Research, Osaka University, Suita, Osaka, Japan
    Search for articles by this author
  • Norimitsu Inoue
    Affiliations
    Department of Molecular Genetics, Wakayama Medical University, Wakayama, Wakayama, Japan
    Search for articles by this author
  • Naoya Hamaue
    Affiliations
    Department of Food and Chemical Toxicology, School of Pharmaceutical Sciences, Health Sciences University of Hokkaido, Ishikari-Tobetsu, Hokkaido, Japan
    Search for articles by this author
  • Keiji Wada
    Affiliations
    Department of Food and Chemical Toxicology, School of Pharmaceutical Sciences, Health Sciences University of Hokkaido, Ishikari-Tobetsu, Hokkaido, Japan
    Search for articles by this author
  • Yoshiko Murakami
    Correspondence
    For correspondence: Yoshiko Murakami; Daisuke Kobayashi
    Affiliations
    Laboratory of Immunoglycobiology, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka, Japan

    WPI Immunology Frontier Research Center, Osaka University, Suita, Osaka, Japan
    Search for articles by this author
Open AccessPublished:October 26, 2022DOI:https://doi.org/10.1016/j.jbc.2022.102640
      Extracellular hydrolysis of flavin-adenine dinucleotide (FAD) and flavin mononucleotide (FMN) to riboflavin is thought to be important for cellular uptake of vitamin B2 because FAD and FMN are hydrophilic and do not pass the plasma membrane. However, it is not clear whether FAD and FMN are hydrolyzed by cell surface enzymes for vitamin B2 uptake. Here, we show that in human cells, FAD, a major form of vitamin B2 in plasma, is hydrolyzed by CD73 (also called ecto-5′ nucleotidase) to FMN. Then, FMN is hydrolyzed by alkaline phosphatase to riboflavin, which is efficiently imported into cells. We determined that this two-step hydrolysis process is impaired on the surface of glycosylphosphatidylinositol (GPI)-deficient cells due to the lack of these GPI-anchored enzymes. During culture of GPI-deficient cells with FAD or FMN, we found that hydrolysis of these forms of vitamin B2 was impaired, and intracellular levels of vitamin B2 were significantly decreased compared with those in GPI-restored cells, leading to decreased formation of vitamin B2-dependent pyridoxal 5′-phosphate and mitochondrial dysfunction. Collectively, these results suggest that inefficient uptake of vitamin B2 might account for mitochondrial dysfunction seen in some cases of inherited GPI deficiency.

      Keywords

      Abbreviations:

      ALP (alkaline phosphatase), AMP (adenosine 5′-monophosphate), APCP (α,β-methylene adenosine 5′-diphosphate), FAD (flavin-adenine dinucleotide), FMN (flavin mononucleotide), GPI (glycosylphosphatidylinositol), GPI-AP (GPI-anchored protein), HPP (hypophosphatasia), IGD (inherited GPI deficiency), PIGG (phosphatidylinositol glycan anchor biosynthesis class G), PIGT (phosphatidylinositol glycan anchor biosynthesis class T), PL (pyridoxal), PLP (pyridoxal 5′-phosphate), PN (pyridoxine), PNP (pyridoxine 5′-phosphate), RF (riboflavin), TNSALP (tissue-nonspecific ALP), OCR (oxygen consumption rate)
      The water-soluble vitamins are essential to mammals and play roles in various metabolic reactions by working as coenzymes. The major forms of vitamins B1, B2, and B6 in blood are phosphorylated or nucleotide forms (
      • Rindi G.
      • Patrini C.
      • Poloni M.
      Monophosphate, the only phosphoric ester of thiamin in the cerebro-spinal fluid.
      ,
      • Hustad S.
      • Ueland P.M.
      • Schneede J.
      Quantification of riboflavin, flavin mononucleotide, and flavin adenine dinucleotide in human plasma by capillary electrophoresis and laser-induced fluorescence detection.
      ,
      • Vasilaki A.T.
      • McMillan D.C.
      • Kinsella J.
      • Duncan A.
      • O’Reilly D.S.J.
      • Talwar D.
      Relation between riboflavin, flavin mononucleotide and flavin adenine dinucleotide concentrations in plasma and red cells in patients with critical illness.
      ,
      • Talwar D.
      • Quasim T.
      • McMillan D.C.
      • Kinsella J.
      • Williamson C.
      • O’Reilly D.S.J.
      Optimisation and validation of a sensitive high-performance liquid chromatography assay for routine measurement of pyridoxal 5-phosphate in human plasma and red cells using pre-column semicarbazide derivatisation.
      ,
      • Ueland P.M.
      • Ulvik A.
      • Rios-Avila L.
      • Midttun O.
      • Gregory J.F.
      Direct and functional biomarkers of vitamin B6 status.
      ,
      • Akiyama T.
      • Hayashi Y.
      • Hanaoka Y.
      • Shibata T.
      • Akiyama M.
      • Tsuchiya H.
      • et al.
      Pyridoxal 5′-phosphate, pyridoxal, and 4-pyridoxic acid in the paired serum and cerebrospinal fluid of children.
      ) and they need to be hydrolyzed for uptake by cells. Alkaline phosphatase (ALP), a glycosylphosphatidylinositol (GPI)-anchored protein (GPI-AP), dephosphorylates thiamine pyrophosphate and pyridoxal 5′-phosphate (PLP) to thiamine and pyridoxal (PL), respectively (
      • Luong K.V.Q.
      • Nguyen L.T.H.
      Adult hypophosphatasia and a low level of red blood cell thiamine pyrophosphate.
      ,
      • Millán J.L.
      • Whyte M.P.
      Alkaline phosphatase and hypophosphatasia.
      ). However, it is uncertain whether the active forms of vitamin B2, flavin-adenine dinucleotide (FAD) and flavin mononucleotide (FMN) (Fig. 1A), are hydrolyzed by the cell surface enzyme for their uptake. Moreover, enzymes which hydrolyze them are not known (
      • Barile M.
      • Giancaspero T.A.
      • Leone P.
      • Galluccio M.
      • Indiveri C.
      Riboflavin transport and metabolism in humans.
      ).
      Figure thumbnail gr1
      Figure 1Structures of vitamin B2 analogues and hydrolysis of flavin mononucleotide (FMN) and flavin-adenine dinucleotide (FAD) hydrolysis. A, structures of FAD and metabolites of FAD. B, FMN and FAD hydrolysis by human bone alkaline phosphatase (ALP) and recombinant human CD73. Riboflavin (RF) and FMN concentrations were measured 15 min after incubation of 10 μM FMN or FAD, respectively, with ALP (10 μg/ml) or CD73 (10 ng/ml). Data represent means ± SD (n = 3). N.D.: not detectable.
      In food, vitamin B2 is mainly in the form of FAD or FMN. Because they are hydrophilic, they are not imported directly into the intestinal epithelial cells; instead, they must be converted to riboflavin (RF, Fig. 1A) on cell surface for uptake (
      • Akiyama T.
      • Selhub J.
      • Rosenberg I.H.
      FMN phosphatase and FAD pyrophosphatase in rat intestinal brush borders: role in intestinal absorption of dietary riboflavin.
      ,
      • Daniel H.
      • Binninger E.
      • Rehner G.
      Hydrolysis of FMN and FAD by alkaline phosphatase of the intestinal brush-border membrane.
      ). RF uptake into cells is mediated by three kinds of RF transporters (SLC52A1, 2, 3) (
      • Barile M.
      • Giancaspero T.A.
      • Leone P.
      • Galluccio M.
      • Indiveri C.
      Riboflavin transport and metabolism in humans.
      ). FMN and FAD are then regenerated from RF in the cytoplasm by RF kinase and FAD synthetase (
      • Barile M.
      • Giancaspero T.A.
      • Leone P.
      • Galluccio M.
      • Indiveri C.
      Riboflavin transport and metabolism in humans.
      ,
      • Said H.M.
      • Arianas P.
      Transport of riboflavin in human intestinal brush border membrane vesicles.
      ). These active forms of vitamin B2 work as cofactors of various enzymes involved in redox reactions in many metabolic pathways, such as the tricarboxylic acid cycle, vitamin B6 metabolism, and mitochondrial electron transport chain. Therefore, vitamin B2 deficiency causes mitochondrial dysfunction as well as various metabolic disorders (
      • Barile M.
      • Giancaspero T.A.
      • Leone P.
      • Galluccio M.
      • Indiveri C.
      Riboflavin transport and metabolism in humans.
      ).
      One candidate enzyme involved in the hydrolysis of FMN and FAD is ALP. Daniel et al. (
      • Daniel H.
      • Binninger E.
      • Rehner G.
      Hydrolysis of FMN and FAD by alkaline phosphatase of the intestinal brush-border membrane.
      ) reported that FMN and FAD were hydrolyzed by ALP purified from the brush-border membrane of rat jejunum. ALP hydrolyzes compounds with a phosphate moiety, such as pyrophosphate, phosphoethanolamine, and PLP (
      • Millán J.L.
      • Whyte M.P.
      Alkaline phosphatase and hypophosphatasia.
      ). There are four main isoforms of ALP in humans—tissue-nonspecific ALP (TNSALP), intestinal ALP, germ cell ALP, and placental ALP—all of which are GPI-APs (
      • Zimmermann H.
      • Zebisch M.
      • Sträter N.
      Cellular function and molecular structure of ecto-nucleotidases.
      ). Among them, TNSALP is ubiquitously expressed and is the major isoform expressed in liver, bone, kidney, blood, and brain (
      • Millán J.L.
      Alkaline phosphatases.
      ).
      Although, Daniel et al. (
      • Daniel H.
      • Binninger E.
      • Rehner G.
      Hydrolysis of FMN and FAD by alkaline phosphatase of the intestinal brush-border membrane.
      ) reported that both FMN and FAD were hydrolyzed by ALP, there are several reports suggesting that two enzymes are involved in the hydrolysis of FMN and FAD. Akiyama et al. purified two independent enzymes, FAD pyrophosphatase and FMN phosphatase, from rat intestinal brush-border (
      • Akiyama T.
      • Selhub J.
      • Rosenberg I.H.
      FMN phosphatase and FAD pyrophosphatase in rat intestinal brush borders: role in intestinal absorption of dietary riboflavin.
      ). Okuda showed that the inhibitory effect of pyrophosphate was greater against FMN hydrolysis than FAD hydrolysis in dog intestinal mucosa and suggested that the small intestine contains at least two kinds of phosphatase: nucleotide pyrophosphatase with low affinity for pyrophosphate and phosphomonoesterase with high-affinity for pyrophosphate (
      • Okuda J.
      Metabolism of flavin nucleotides. I. Of flavin nucleotides in digestive juice. Decomposition.
      ). Okuda also reported that gastric juice hydrolyzes only FAD, and bile and pancreatic juice hydrolyze only FMN (
      • Okuda J.
      Metabolism of flavin nucleotides. II. Decomposition of flavin nucleotides in the small intestine.
      ). Lee and Ford showed that an enzyme purified from placental trophoblastic microvilli possessed FAD pyrophosphatase activity and the enzyme did not hydrolyze FMN (
      • Lee R.S.F.
      • Ford H.C.
      5’-Nucleotidase of human placental trophoblastic microvilli possesses cobalt-stimulated FAD pyrophosphatase activity.
      ). These reports suggest a two-step hydrolysis of FAD (i.e., FAD–FMN, then FMN–RF).
      Here, we show that, in human cells, FAD is hydrolyzed in two steps: FAD to FMN by CD73 and FMN to RF by ALP. CD73, also known as ecto-5′ nucleotidase, is a GPI-AP encoded by the NT5E gene and catalyzes conversion of adenosine 5′-monophosphate (AMP) to adenosine (
      • Zimmermann H.
      • Zebisch M.
      • Sträter N.
      Cellular function and molecular structure of ecto-nucleotidases.
      ,
      • Picher M.
      • Burch L.H.
      • Hirsh A.J.
      • Spychala J.
      • Boucher R.C.
      Ecto 5′-nucleotidase and nonspecific alkaline phosphatase: two AMP-hydrolyzing ectoenzymes with distinct roles in human airways.
      ). To determine the hydrolytic activity of human bone ALP and recombinant human CD73 toward vitamin B2 analogues, RF formation from FMN and FMN formation from FAD were measured. The contributions of these GPI-APs to vitamin B2 uptake, vitamin B2-dependent vitamin B6 metabolism, and mitochondrial function were determined using GPI-deficient cells. Because CD73 and ALP are both GPI-APs (
      • Zimmermann H.
      • Zebisch M.
      • Sträter N.
      Cellular function and molecular structure of ecto-nucleotidases.
      ,
      • Misumi Y.
      • Ogata S.
      • Ohkubo K.
      • Hirose S.
      • Ikehara Y.
      Primary structure of human placental 5′-nucleotidase and identification of the glycolipid anchor in the mature form.
      ), GPI-deficient cells contained a decreased amount of intracellular vitamin B2 when cultured with FAD as the vitamin B2 source, leading to changes in vitamin B6 metabolism and mitochondrial dysfunction. These lines of evidence suggest that the mitochondrial dysfunction seen in some severe cases of inherited GPI deficiency (IGD) might be caused by vitamin B2 deficiency, which would be prevented by the administration of RF.

      Results

      RF formation from FMN by ALP and FMN formation from FAD by CD73

      To analyze the two-step hydrolysis of FAD, RF and FMN concentrations were measured in vitro by HPLC after incubation of 10 μM FMN and FAD, respectively, with human bone ALP and CD73 containing a C-terminal His tag in solution for 15 min. An increase in the RF concentration was detected after incubation of FMN with ALP but not with CD73. In contrast, the FMN concentration was increased after incubation of FAD with CD73 but not with ALP (Fig. 1B).
      ALP-dependent RF formation from FMN is shown in Figure 2, AC, including a time course and the dependence on the concentrations of ALP and FMN, respectively. RF production increased linearly for 10 min (Fig. 2A) in an ALP concentration-dependent manner (Fig. 2B). RF production from FMN by ALP was substrate saturable (Fig. 2C), the Km and Vmax values being 0.309 ± 0.051 μM and 7.47 ± 0.25 nmol/min/mg protein, respectively (Table 1). These results demonstrate that purified bone ALP, that is, TNSALP, hydrolyzes FMN, producing RF.
      Figure thumbnail gr2
      Figure 2Flavin-adenine dinucleotide (FMN) hydrolysis by human bone alkaline phosphatase (ALP) and flavin-adenine dinucleotide (FAD) hydrolysis by recombinant human CD73. A, time course of riboflavin (RF) production from FMN by ALP. The RF concentration was measured after incubation of 10 μM FMN with ALP (10 μg/ml). Data represent means ± SD (n = 3). B, ALP concentration dependence of RF production from FMN. The RF concentration was measured 5 min after incubation of 10 μM FMN with ALP (2.5–10 μg/ml). Data represent means ± SD (n = 3). C, Michaelis–Menten plot of RF production from FMN by human bone ALP. The RF concentration was measured 5 min after incubation of FMN (0.5–5 μM) with ALP (5 μg/ml). The enzyme activity was expressed in product concentration per minute per mg protein. Data represent means ± SD (n = 3). D and G, time course of FMN production (D) or adenosine production (G) from FAD by CD73. The FMN or adenosine concentration was measured after incubation of 10 μM FAD with CD73 (10 ng/ml). Data represent means ± SD (n = 3). E and H, CD73 concentration dependence of FMN production (E) or adenosine production (H) from FAD by recombinant CD73. The FMN or adenosine concentration was measured 15 min after incubation of 10 μM FAD with CD73 (5–20 ng/ml). Data represent means ± SD (n = 3). F and I, Michaelis-Menten plot of FMN production (F) or adenosine production (I) from FAD by recombinant CD73. The FMN or adenosine concentration was measured 15 min after incubation of 10 μM FAD with CD73 (10 ng/ml). The enzyme activity was expressed in product concentration per minute per μg protein. Data represent means ± SD (n = 3). When the SD is smaller than the symbols, it is not shown.
      Table 1Kinetic parameters for hydrolysis reactions catalyzed by human bone ALP and recombinant human CD73
      a) ALPKmVmax
      (μM)(nmol/min/mg protein)
      FMN → RF0.309 ± 0.0517.47 ± 0.25
      AMP → adenosine0.538 ± 0.04713.8 ± 0.4
      b) CD73KmVmax
      (μM)(nmol/min/μg protein)
      FAD → FMN18.4 ± 0.312.3 ± 0.3
      FAD → adenosine23.7 ± 1.513.2 ± 0.3
      AMP → adenosine3.94 ± 0.51188 ± 7
      The Vmax was expressed in product concentration per minute per mg or μg protein. Data represent means ± standard errors.
      Abbreviations: ALP, alkaline phosphatase; AMP, adenosine 5′-monophosphate; FAD, flavin-adenine dinucleotide; FMN, flavin mononucleotide; RF, riboflavin.
      Recombinant CD73-dependent FMN formation from FAD is shown in Figure 2, DF. Because FAD consists of RF, diphosphate, and adenosine moieties, AMP (adenosine + phosphate) or adenosine could be produced by FAD hydrolysis (Fig. 1A). To determine the products of FAD hydrolysis by CD73, we simultaneously determined FMN, AMP, and adenosine by HPLC after incubation of FAD with CD73. Increased concentrations of FMN and adenosine were detected, but no increase in AMP was observed. The concentrations of FMN and adenosine increased linearly for 30 min (Fig. 2, D and G) in a CD73 concentration-dependent manner (Fig. 2, E and H). FMN and adenosine production by CD73 was dependent on the concentration of the substrate, FAD, and was saturable (Fig. 2, F and I). CD73 is known to hydrolyze AMP to adenosine; in addition, here, we show evidence that recombinant CD73 also hydrolyzes FAD to produce FMN and adenosine.

      Kinetic parameters of ALP and CD73 activities

      We determined kinetic parameters of the activities of ALP and CD73 (Table 1). Because AMP is a substrate for both CD73 and ALP (
      • Zimmermann H.
      • Zebisch M.
      • Sträter N.
      Cellular function and molecular structure of ecto-nucleotidases.
      ,
      • Picher M.
      • Burch L.H.
      • Hirsh A.J.
      • Spychala J.
      • Boucher R.C.
      Ecto 5′-nucleotidase and nonspecific alkaline phosphatase: two AMP-hydrolyzing ectoenzymes with distinct roles in human airways.
      ), the results for kinetic analysis of FMN and FAD hydrolysis are compared with those for AMP hydrolysis in Table 1. The Km value for FAD hydrolysis by CD73 was higher than that for AMP, and the Vmax value for AMP hydrolysis was higher than that for FAD hydrolysis, suggesting that CD73 binds AMP with higher affinity than FAD and more efficiently hydrolyzes AMP than FAD. In contrast, the Km values for FMN and AMP hydrolysis by ALP were comparable.

      Inhibition studies of ALP and CD73

      Several types of inhibitors were used to characterize the hydrolytic properties of CD73 and ALP (Fig. 3). FMN hydrolysis and AMP hydrolysis by ALP showed similar patterns of inhibition (Fig. 3A). FAD hydrolysis and AMP hydrolysis by CD73 also showed similar patterns of inhibition (Fig. 3B). However, the inhibition properties of AMP hydrolysis mediated by ALP and CD73 were different. FMN and nicotinamide mononucleotide, which are phosphorylated vitamins, and levamisole, which is an inhibitor of TNSALP (
      • Kozlenkov A.
      • le Du M.H.
      • Cuniasse P.
      • Ny T.
      • Hoylaerts M.F.
      • Millán J.L.
      Residues determining the binding specificity of uncompetitive inhibitors to tissue-nonspecific alkaline phosphatase.
      ), decreased the activity of ALP but not CD73. In contrast, α,β-methylene adenosine 5′-diphosphate (APCP), an inhibitor of CD73 (
      • Bhattarai S.
      • Freundlieb M.
      • Pippel J.
      • Meyer A.
      • Abdelrahman A.
      • Fiene A.
      • et al.
      α,β-Methylene-ADP (AOPCP) derivatives and analogues: development of potent and selective ecto-5′-nucleotidase (CD73) inhibitors.
      ), inhibited CD73 but not ALP. Guanosine 5′-monophosphate, a nucleotide, inhibited both CD73 and ALP, which is consistent with AMP being a common substrate of CD73 and ALP (Fig. 3C). Figures 2 and 3 demonstrate that TNSALP hydrolyzes FMN, producing RF, and CD73 hydrolyzes FAD, producing FMN.
      Figure thumbnail gr3
      Figure 3Inhibition of alkaline phosphatase (ALP) and CD73. A, comparison of inhibitory effect of various compounds on hydrolysis of 1 μM flavin mononucleotide (FMN) and 1 μM adenosine 5'-monophosphate (AMP) by ALP. FMN hydrolysis activities were measured by riboflavin (RF) production from FMN; AMP hydrolysis activities were measured by adenosine production from AMP. The concentration of the inhibitors was 10 μM, except for α,β-methylene adenosine 5′-diphosphate (APCP; 2 μM) and levamisole (1 mM). Data represent means ± SD (n = 3). When the SD is smaller than the symbols, it is not shown. B, comparison of inhibitory effects of various compounds on hydrolysis of 10 μM flavin-adenine dinucleotide (FAD) and 4 μM AMP by CD73. FAD hydrolysis activities were measured by FMN production from FAD; AMP hydrolysis activities were measured by adenosine production from AMP. The concentration of the inhibitors was 10 μM, except for APCP (2 μM) and levamisole (1 mM). Data represent means ± SD (n = 3). When the SD is smaller than the symbols, it is not shown. C, comparison of inhibitory effects of various compounds on hydrolysis of 1 and 4 μM AMP by ALP and CD73, respectively. AMP hydrolysis activities were measured by adenosine production from AMP. The concentration of the inhibitors was 10 μM, except for APCP (2 μM) and levamisole (1 mM). Data represent means ± SD (n = 3). When the SD is smaller than the symbols, it is not shown.

      Extracellular hydrolysis and uptake of vitamin B2, and vitamin B2-dependent PLP and PL production in GPI-deficient cells

      Both CD73 and ALP are GPI-APs (
      • Zimmermann H.
      • Zebisch M.
      • Sträter N.
      Cellular function and molecular structure of ecto-nucleotidases.
      ,
      • Misumi Y.
      • Ogata S.
      • Ohkubo K.
      • Hirose S.
      • Ikehara Y.
      Primary structure of human placental 5′-nucleotidase and identification of the glycolipid anchor in the mature form.
      ) and phosphatidylinositol glycan anchor biosynthesis class T (PIGT) is required for GPI-AP generation, and therefore, PIGT-KO SH-SY5Y cells (PIGT− cells) were generated using the CRISPR/Cas9 system to obtain CD73-and ALP-defective cells. SH-SY5Y is the human neuroblastoma cell line. The activities of CD73 and ALP in PIGT− cells were significantly lower than in PIGT rescued cells (PIGT+ cells) (Fig. 4, A and B). Surface expression levels of CD73, TNSALP, and CD59 (another GPI-AP) on PIGT− and PIGT+ cells were compared by flow cytometric analysis (Fig. 4C). The surface expression of CD73, TNSALP, and CD59 was deficient in PIGT− cells.
      Figure thumbnail gr4
      Figure 4Extracellular hydrolysis and uptake of vitamin B2, and vitamin B2-dependent pyridoxal 5′-phosphate (PLP) and pyridoxal (PL) production in glycosylphosphatidylinositol (GPI)-deficient cells. A, alkaline phosphatase (ALP) activities in phosphatidylinositol glycan anchor biosynthesis class T (PIGT)-expressing (PIGT+) or vector-transfected (PIGT−) SH-SY5Y cells. ALP activities were measured in lysates of PIGT+ and PIGT− cells. The ALP activity is expressed in terms of the amount of placental ALP (PLAP) in the kit, which was used as a positive control. Data represent means ± SD (n = 4). ∗∗Indicates a significant difference (p < 0.01) compared with PIGT+ cells. B, CD73 activities in PIGT+ or PIGT− SH-SY5Y cells. CD73 activities were measured by APCP-sensitive adenosine production from AMP in lysate of PIGT+ or PIGT− SH-SY5Y cells. Data represent means ± SD (n = 3). ∗∗Indicates a significant difference (p < 0.01) compared with PIGT+ cells. C, surface expression of CD73, ALP, and CD59 on PIGT− and PIGT+ SHSY5Y cells. Mean fluorescent intensity (MFI) of PIGT+ versus PIGT−; CD73, 177 versus 82; ALP, 472 versus 102; CD59, 10,093 versus 77. The analysis was repeated at least three times. D, residual amount of vitamin B2 in medium after 24 h of cultivation of PIGT+ or PIGT− SH-SY5Y cells in medium containing flavin mononucleotide (FMN), flavin-adenine dinucleotide (FAD), riboflavin (RF), or no vitamin B2. The residual amount of vitamin B2 in medium is expressed as the percentage of the total vitamin B2 concentration (FAD + FMN + RF) in medium incubated without cells. The data represent means for FAD (white), FMN (gray), and RF (black). Error bars represent the SD for total vitamin B2. ∗∗Indicates a significant difference (p < 0.01) in the residual amount of total vitamin B2 in the medium. ND: not detectable. E, intracellular vitamin B2 amount after 24 h of cultivation of PIGT+ or PIGT− SH-SY5Y cells in medium containing FMN, FAD, RF, or no vitamin B2. The data represent means for FAD (white), FMN (gray), and RF (black). Error bars represent the SD for total vitamin B2. ∗∗Indicates a significant difference (p < 0.01) in the total vitamin B2 concentration in cells. #, ##indicates a significant difference (p < 0.05, p < 0.01, respectively) in FMN concentration in cells. ††indicates a significant difference (p < 0.01) in FAD concentration in cells. ND: not detectable. F, PLP and PL concentration in medium after 24 h of cultivation of PIGT+ or PIGT− SH-SY5Y cells in medium containing FMN, FAD, RF, or no vitamin B2. The data represent means for PLP (gray) and PL (black). Error bars represent the SD of the sum of PLP and PL. ∗∗Indicates a significant difference (p < 0.01) in the sum of PLP and PL in the medium. ND: not detectable. G, correlation between intracellular FMN concentration and the sum of PL and PLP concentration after 24 h of cultivation of PIGT+ (closed circles) or PIGT− (open circles) SH-SY5Y cells in medium containing FMN, FAD, RF, or no vitamin B2. The data represent means ± SD (n = 3). Statistical analysis: Student's t test for (A and B); ANOVA followed by the Tukey–Kramer test for (D–F); Pearson correlation for (G).
      PIGT− and PIGT+ cells were cultured in vitamin B2-depleted medium for 5 days, followed by culture for 24 h in a medium containing one of the vitamin B2 derivatives (FMN, FAD, or RF) or a medium without vitamin B2. Vitamin B2 concentrations in the cell and culture medium were measured by HPLC. FAD was the major form of vitamin B2 in the PIGT+ and PIGT− cells after cultured in medium containing RF, FMN, or FAD, indicating that imported RF was intracellularly converted to FAD (
      • Barile M.
      • Giancaspero T.A.
      • Leone P.
      • Galluccio M.
      • Indiveri C.
      Riboflavin transport and metabolism in humans.
      ). The intracellular total vitamin B2 concentrations were significantly lower in PIGT− cells than in PIGT+ cells after cultured in FMN- or FAD-containing medium, while they were similar after cultured in RF-containing or vitamin B2-depleted medium (Fig. 4D) (because RF can be transported into the cells by RF transporters).
      In the media, total vitamin B2 and FAD were significantly higher (91.2 ± 2.1% versus 47.3 ± 0.3%, p < 0.01) and FMN was significantly lower (2.2 ± 0.4 % versus 36.2 ± 2.0%, p < 0.01) for PIGT− cells cultured with medium containing FAD than for PIGT+ cells, suggesting that FAD was not efficiently hydrolyzed to FMN by PIGT− cells (Fig. 4E). FMN was significantly higher (80.1 ± 2.1% versus 75.0 ± 0.3%, p < 0.05) for PIGT− cells cultured with medium containing FMN than for PIGT+ cells, suggesting that FMN was not efficiently hydrolyzed to RF by PIGT− cells (Fig. 4E). However, when cultured with medium containing RF, there was no difference in vitamin B2 concentration in medium between PIGT− and PIGT+ cells (Fig. 4E).
      These results indicate that the presence of FAD and FMN in the medium did not lead to efficient uptake of vitamin B2 into GPI-deficient cells; this is because FAD and FMN were inefficiently hydrolyzed to FMN and RF, respectively, because of the defective expression of CD73 and ALP; this resulted in intracellular vitamin B2 deficiency.
      To analyze the effect of intracellular vitamin B2 deficiency on the activity of vitamin B2-dependent enzymes, concentrations of vitamin B6 derivatives in the medium were measured. Pyridoxine (PN, a form of vitamin B6) is imported into cells and phosphorylated to pyridoxine 5′-phosphate (PNP). PNP is then converted to PLP by the FMN-dependent enzyme PNP oxidase, and PLP is in turn dephosphorylated to PL; PL and PLP are efficiently exported to the medium (
      • Anderson B.B.
      • Fulford-Jones C.E.
      • Child J.A.
      • Beard M.E.
      • Bateman C.J.
      Conversion of vitamin B 6 compounds to active forms in the red blood cell.
      ,
      • Anderson B.B.
      • Saary M.
      • Stephens A.D.
      • Perry G.M.
      • Lersundi I.C.
      • Horn J.E.
      Effect of riboflavin on red-cell metabolism of vitamin B6.
      ,
      • da Silva V.R.
      • Russell K.A.
      • Gregory J.F.
      Vitamin B6.
      ). Extracellular PL and PLP should be a biomarker for intracellular vitamin B2 status because sum of PLP and PL is a net produced amount of metabolites by FMN-dependent PNP oxidase from PN which is contained in all precultured media as a vitamin B6 source. After cultivation of PIGT+ and PIGT− cells in the presence of PN and FAD, the combined PL and PLP concentration in the medium was significantly lower for PIGT− cells than for PIGT+ cells (Fig. 4F). There was a significant positive relationship between the sum of PL and PLP concentrations in the medium and the intracellular FMN concentration (p < 0.001, Fig. 4G). These results suggest that the amount of vitamin B2 imported into the cells affected the vitamin B2-dependent PLP and PL production.

      Effect of intracellular vitamin B2 deficiency on mitochondrial function

      FMN and FAD act as coenzymes in the mitochondrial electron transport chain, and a decreased intracellular FAD concentration might cause mitochondrial dysfunction (
      • Udhayabanu T.
      • Manole A.
      • Rajeshwari M.
      • Varalakshmi P.
      • Houlden H.
      • Ashokkumar B.
      Riboflavin responsive mitochondrial dysfunction in neurodegenerative diseases.
      ). To compare the mitochondrial function between PIGT+ and PIGT− SHSY5Y cells, O2 consumption of cells was measured using a flux analyzer. After culture in vitamin B2-depleted medium for 5 days, cells were cultured in medium containing a vitamin B2 derivative (FAD, RF, or no vitamin B2) for 24 h and their O2 consumption was then measured (Fig. 5). PIGT− cells showed significantly lower O2 consumption than PIGT+ cells when they were cultured in FAD-containing medium, whereas those cultured in RF-containing medium showed a similar level of O2 consumption to that in PIGT+ cells. These results suggest that the GPI-deficient cells are susceptible to mitochondrial dysfunction. Additionally, non-mitochondrial O2 consumption, which is the residual O2 consumption after addition of rotenone/antimycin A, was also decreased in PIGT-cells, suggesting the contribution of some flavoenzyme oxidases.
      Figure thumbnail gr5
      Figure 5O2 consumption by SHST5Y phosphatidylinositol glycan anchor biosynthesis class T (PIGT) vector-transfected (PIGT−) or PIGT-expressing (PIGT+) cells, measured by flux analysis and scheme of relationship between vitamin B2 metabolism and mitochondria function. A and B, cells were incubated in the measuring plates with vitamin B2-depleted medium for 4 days. The medium was changed to the indicated conditions and the cells were further incubated for 24 h. Then, O2 consumption was measured. Oligomycin is an ATP synthase inhibitor; carbonyl cyanide p-trifluoromethoxyphenylhydrazone (carbonilcyanide p-triflouromethoxyphenylhydrazone) is an uncoupler; rotenone is a complex I inhibitor; and antimycin A is a complex III inhibitor. The data represent means ± SD (n = 2). Representative data from two independent experiments are shown. C, scheme of hydrolysis of flavin-adenine dinucleotide (FAD) and flavin mononucleotide (FMN) by CD73 and alkaline phosphatase for its uptake into cells, vitamin B6 metabolism, and mitochondria function.

      Discussion

      The present study showed that purified human TNSALP from bone hydrolyzed FMN and recombinant human CD73 hydrolyzed FAD. ALP catalyzes the hydrolysis of monoesters of phosphoric acid (
      • Millán J.L.
      Alkaline phosphatases.
      ). Here, we showed that ALP hydrolyzes monophosphate vitamin B2, FMN, but not dinucleotide-type vitamin B2, FAD. Inhibition study showed that guanosine 5′-monophosphate and nicotinamide mononucleotide inhibited ALP activity, but NAD and FAD did not, suggesting that ALP has high affinity for compounds with a phosphomonoester moiety.
      We also showed that adenosine and FMN were produced from FAD by CD73. Because AMP hydrolysis had a higher Vmax and lower Km than FAD hydrolysis by CD73, we speculate that adenosine was immediately produced from AMP after AMP and FMN production from FAD, with conversion of FAD to FMN being rate limiting. However, at the moment, we cannot completely eliminate the possibility of flavin-pyrophosphate as an intermediate.
      TNSALP from human bone was used in the present study. TNSALP hydrolyzes some phosphate compounds, such as inorganic pyrophosphate, PLP (vitamin B6), and thiamine pyrophosphate (vitamin B1). Hypophosphatasia (HPP) is caused by loss-of-function mutations in TNSALP. Decreased conversion of pyrophosphate to phosphate caused dysosteogenesis (
      • Millán J.L.
      • Whyte M.P.
      Alkaline phosphatase and hypophosphatasia.
      ). Because cell surface hydrolysis of PLP to PL is important for vitamin B6 uptake into cells, decreased PLP hydrolysis activity causes vitamin B6 deficiency, leading to dysfunction of various vitamin B6-dependent enzymes such as glutamate decarboxylase which results in PN-dependent seizures (
      • Millán J.L.
      • Whyte M.P.
      Alkaline phosphatase and hypophosphatasia.
      ,
      • Akiyama T.
      • Kubota T.
      • Ozono K.
      • Michigami T.
      • Kobayashi D.
      • Takeyari S.
      • et al.
      Pyridoxal 5′-phosphate and related metabolites in hypophosphatasia: effects of enzyme replacement therapy.
      ). In HPP, lowered levels of thiamine pyrophosphate in red blood cells were reported (
      • Luong K.V.Q.
      • Nguyen L.T.H.
      Adult hypophosphatasia and a low level of red blood cell thiamine pyrophosphate.
      ). Adenosine and γ-aminobutyric acid concentrations were lower in brain of Akp2 KO mice than in wild-type mice; this gene encodes TNSALP in mice (
      • Cruz T.
      • Gleizes M.
      • Balayssac S.
      • Mornet E.
      • Marsal G.
      • Millán J.L.
      • et al.
      Identification of altered brain metabolites associated with TNAP activity in a mouse model of hypophosphatasia using untargeted NMR-based metabolomics analysis.
      ). The present study showed that the phosphorylated form of vitamin B2, FMN, is a substrate of human TNSALP. Because hydrolysis by ALP of vitamin B1, B2, and B6 is required for their uptake, their uptake would be decreased in HPP, which will be a subject of future investigation.
      Analysis using GPI-deficient cells, which are defective in both CD73 and ALP cell surface expression, showed that both FAD and FMN uptake activities were lower than in GPI-rescued cells, leading to intracellular deficiency of vitamin B2. Thus, the GPI-deficient cells showed dysfunction of the vitamin B2-dependent mitochondrial respiratory chain complex, as well as of PNP oxidase, and enzyme in vitamin B6 metabolism. GPI-deficient cells showed significantly lower PLP and PL production and O2 consumption when they were incubated with FAD than PIGT+ cells, whereas those incubated with RF showed a similar level to that in PIGT+ cells (Figs. 4 and 5F and 5, A and B). In addition, a significant positive relationship was found between the concentration of intracellular FMN and the sum of PLP and PL production (Fig. 4G). These results again suggest that cell surface hydrolysis of FAD to RF by the CD73 and ALP contributed to vitamin B2-dependent functions (Fig. 5C). However, it might be still possible that some other GPI-APs contribute to these functions.
      IGD is caused by mutations in genes involved in the biosynthesis or modification of GPI-APs. Major symptoms of patients with IGD are intellectual disability, developmental delay, and seizures. Because both ALP and CD73 are GPI-APs, expression of these proteins is decreased in some patients with IGD. Here, we demonstrated that GPI-deficient cells showed decreased intracellular vitamin B2 levels when cultured with FAD, a major form of vitamin B2 in blood, which led to mitochondrial dysfunction. This is consistent with reports that some severe IGD cases show mitochondrial dysfunction (
      • Tarailo-Graovac M.
      • Sinclair G.
      • Stockler-Ipsiroglu S.
      • van Allen M.
      • Rozmus J.
      • Shyr C.
      • et al.
      The genotypic and phenotypic spectrum of PIGA deficiency.
      ). In future, we are planning to analyze the metabolic conditions in vivo using IGD model mice (
      • Kuwayama R.
      • Suzuki K.
      • Nakamura J.
      • Aizawa E.
      • Yoshioka Y.
      • Ikawa M.
      • et al.
      Establishment of mouse model of inherited PIGO deficiency and therapeutic potential of AAV-based gene therapy.
      ). CD73 expression is decreased in phosphatidylinositol glycan anchor biosynthesis class G (PIGG) KO cells (
      • Ishida M.
      • Maki Y.
      • Ninomiya A.
      • Takada Y.
      • Campeau P.
      • Kinoshita T.
      • et al.
      Ethanolamine-phosphate on the second mannose is a preferential bridge for some GPI-anchored proteins.
      ) and some cases with null mutation of PIGG also showed decreased expression of CD73 and mitochondrial dysfunction (
      • Tremblay-Laganière C.
      • Maroofian R.
      • Nguyen T.T.M.
      • Karimiani E.G.
      • Kirmani S.
      • Akbar F.
      • et al.
      PIGG variant pathogenicity assessment reveals characteristic features within 19 families.
      ), suggesting that CD73 expression is important for uptake of vitamin B2 in PIGG deficiency. Similar to HPP, some patients with IGD show decreased vitamin B6 uptake and suffer from PN-dependent seizures (
      • Kuki I.
      • Takahashi Y.
      • Okazaki S.
      • Kawawaki H.
      • Ehara E.
      • Inoue N.
      • et al.
      Vitamin B6-responsive epilepsy due to inherited GPI deficiency.
      ). High-dose nonphosphorylated vitamin B6 (i.e., PN) treatment was effective in treatment of seizures in more than half of patients with IGD (
      • Tanigawa J.
      • Nabatame S.
      • Tominaga K.
      • Nishimura Y.
      • Maegaki Y.
      • Kinosita T.
      • et al.
      High-dose pyridoxine treatment for inherited glycosylphosphatidylinositol deficiency.
      ). Two types of nonphosphorylated vitamin B6 are imported into cells and converted to PLP in the cell. One of them, PL, is contained in food from animal sources. PN and its glycoside are contained in food from plant sources (
      • Gregory J.F.
      • Ink S.L.
      Identification and quantification of pyridoxine-β-glucoside as a major form of vitamin B6 in plant-derived foods.
      ); PN is intracellularly converted to PNP, and PNP is converted to PLP by FMN-dependent PNP oxidase (
      • Anderson B.B.
      • Fulford-Jones C.E.
      • Child J.A.
      • Beard M.E.
      • Bateman C.J.
      Conversion of vitamin B 6 compounds to active forms in the red blood cell.
      ,
      • Anderson B.B.
      • Saary M.
      • Stephens A.D.
      • Perry G.M.
      • Lersundi I.C.
      • Horn J.E.
      Effect of riboflavin on red-cell metabolism of vitamin B6.
      ,
      • da Silva V.R.
      • Russell K.A.
      • Gregory J.F.
      Vitamin B6.
      ). In addition to decreased uptake of vitamin B6, patients with IGD would show decreased intracellular conversion of PNP to PLP due to dysfunction of this FMN-dependent enzyme caused by the decreased vitamin B2 uptake. Therefore, high-dose PN and RF treatment might be effective for patients with IGD. However, further study is required concerning vitamin B6 and B2 metabolism in patients with IGD.
      Adenosine, produced by CD73 from AMP, is an immune inhibitory molecule through its receptor expressed on immune cells (
      • Stagg J.
      • Divisekera U.
      • McLaughlin N.
      • Sharkey J.
      • Pommey S.
      • Denoyer D.
      • et al.
      Anti-CD73 antibody therapy inhibits breast tumor growth and metastasis.
      ,
      • Allard B.
      • Longhi M.S.
      • Robson S.C.
      • Stagg J.
      The ectonucleotidases CD39 and CD73: novel checkpoint inhibitor targets.
      ). Some tumors show upregulation of CD73, and adenosine promotes both migration and proliferation (
      • Wang L.
      • Fan J.
      • Thompson L.F.
      • Zhang Y.
      • Shin T.
      • Curiel T.J.
      • et al.
      CD73 has distinct roles in nonhematopoietic and hematopoietic cells to promote tumor growth in mice.
      ). Therefore, CD73 is a target for immunotherapy for cancer. Antibody against CD73 has been used in a phase 1 clinical study (
      • Allard B.
      • Longhi M.S.
      • Robson S.C.
      • Stagg J.
      The ectonucleotidases CD39 and CD73: novel checkpoint inhibitor targets.
      ). Here, we show the importance of CD73 for vitamin B2 uptake. In cancer therapy, the effect of antibody against CD73 on vitamin B2 metabolism should be studied in future study.

      Experimental procedures

      Materials

      Human bone ALP was purchased from Calzyme. Human CD73 His-tag was purchased from BPS Bioscience. All other reagents were of analytical grade.

      Measurement of hydrolysis of FAD

      For measurement of hydrolysis of FAD, FAD and human bone ALP or human CD73 were incubated in reaction buffer containing 50 mM Tris-HCl (pH 7.4), 5 mM MgCl2, and 0.002% bovine serum albumin, after separately preincubation of FAD and the enzyme at 37 °C for 3 min. At an appropriate time, the reaction was stopped by addition of ice-cold perchloric acid and the mixture was centrifuged (9000g for 5 min). The supernatant was transferred to a fresh tube, neutralized by KOH, and recentrifuged. The supernatant was filtered through a 0.45-μm membrane and simultaneously analyzed for FMN, RF, AMP, and adenosine concentrations by HPLC. The HPLC conditions were optimized from a previously reported method (
      • Akimoto M.
      • Sato Y.
      • Okubo T.
      • Todo H.
      • Hasegawa T.
      • Sugibayashi K.
      Conversion of FAD to FMN and riboflavin in plasma: effects of measuring method.
      ). The HPLC apparatus consisted of a Shimadzu LC-10ADvp system equipped with an RF-10Axl spectrofluorometer and SPD-10Avp UV-VIS detector (Shimadzu). Chromatographic separation was performed on an InertSustain AQ-C18 column (150 × 4.6 mm, i.d. 5 μm; GL Sciences) using a gradient elution mode at a flow rate of 1.0 ml/min. The column temperature was 25 °C. Mobile phase A was 10 mM potassium phosphate containing 5 mM EDTA-disodium salt, adjusted to pH 6.0; mobile phase B was methanol. We used a linear gradient from 8% to 25% mobile phase B from 3 min to 6 min, followed by holding at 25% B until 25 min after injection. Fluorescence measurements were made with excitation at 440 nm and emission at 560 nm to determine FMN and RF concentrations. Absorbance measurements were made at 260 nm for the determination of AMP and adenosine. Hydrolysis activity was calculated as observed production minus nonenzymatic production, which was determined in negative controls from which enzyme was absent otherwise using the same procedure as described previously.

      Measurement of hydrolysis of FMN

      For measurement of hydrolysis of FMN, FMN and human bone ALP or human CD73 were incubated in reaction buffer containing 50 mM Tris-HCl (pH 7.4) and 5 mM MgCl2 at 37 °C for 3 min (
      • Coburn S.P.
      • Mahuren J.D.
      • Jain M.
      • Zubovic Y.
      • Wortsman J.
      Alkaline phosphatase (EC 3.1.3.1) in serum is inhibited by physiological concentrations of inorganic phosphate.
      ). The reaction procedures were the same as for analysis of FAD hydrolysis. The produced RF concentration was determined using an isocratic HPLC method with 75% buffer A and 25% buffer B (other conditions the same as for analysis of FAD hydrolysis).

      Measurement of hydrolysis of AMP

      For measurement of hydrolysis of AMP, AMP and human bone ALP or human CD73 were incubated in reaction buffer containing 50 mM Tris-HCl (pH 7.4) and 5 mM MgCl2 at 37 °C for 3 min (
      • Coburn S.P.
      • Mahuren J.D.
      • Jain M.
      • Zubovic Y.
      • Wortsman J.
      Alkaline phosphatase (EC 3.1.3.1) in serum is inhibited by physiological concentrations of inorganic phosphate.
      ). The reaction procedures and HPLC conditions were the same as those for analysis of FAD hydrolysis.

      Generation of GPI-deficient cells

      PIGT-KO cells were generated from SHSY5Y cells (a human neuroblastoma-derived cell line) using the CRIPR/Cas9 system. Plasmid pX330 for expression of human-codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA were obtained from Addgene. The seed sequence for the SpCas9 target site in the target gene was tcggtgcagaccacctcccgcgg (underline; PAM sequence). SHSY5Y cells were transfected with pX330 containing the gRNA of the target site using Lipofectamine 2000 (Invitrogen). KO clones were obtained by limiting dilution, and KO was confirmed by sequencing the target sites in the genomic DNA and by flow cytometric analysis of CD59 expression [staining with mouse anti-hCD59 antibody (5H8) followed by phycoerythrin-conjugated anti-mouse IgG (Biolegend)]. PIGT-KO clone #3 was rescued by transfecting human PIGT-expressing vector pME-puro-3HA-hPIGT. After puromycin selection, the restored population was sorted to obtain PIGT+ cells. PIGT-KO clone #3 was transfected with an empty vector, pME-puro, and the puromycin-resistant population was selected as PIGT− cells. These cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum containing 3 μg/ml puromycin. For flow cytometric analysis, cells were stained with phycoerythrin-conjugated anti-human TNAP (B4-78; isotype, mouse IgG1; Santa Cruz Biotechnology) or anti-human CD73 (AD2, isotype; mouse IgG1; Biolegend) and anti-human CD59 antibody (isotype; mouse IgG1, clone 5H8) followed by phycoerythrin-conjugated goat anti-mouse IgG. Stained cells were analyzed using a MACS QuantVYB analyzer (Miltenyi Biotec).

      Measurement of ALP and CD73 activities in SHSY5Y cell lines

      ALP activities were measured using a Great EscAPe SEAP kit (Takara Bio Inc) in lysates of PIGT+ and PIGT− cells. The ALP activity is expressed in terms of the amount of placental ALP in the kit, which was used as a positive control. CD73 activities were measured by adenosine formation from AMP in lysate from PIGT+ and PIGT− cells. The quantitative method for adenosine using HPLC was described previously in the section “Measurement of hydrolysis of AMP.” The APCP sensitivity of CD73 activity was calculated by subtracting the activity in the presence of 4 μM APCP from the total activity in the absence of APCP.

      Extracellular hydrolysis and uptake of vitamin B2, and vitamin B2-dependent PLP and PL production in GPI-deficient cells

      PIGT− and PIGT+ cells were cultured in vitamin B2-deficient medium for 5 days, followed by culture in medium containing a vitamin B2 derivative (0.2 μM FMN, FAD, RF, or no vitamin B2) for 24 h. Vitamin B2 and B6 concentrations were measured in medium and cells by HPLC. The HPLC conditions for measurement of FAD, FMN, and RF were the same as described previously for measurement of FMN hydrolysis. For the measurement of PL and PLP, a previously reported HPLC method with a fluorescence detector was used after precolumn derivatization with semicarbazide (
      • Kobayashi D.
      • Yoshimura T.
      • Johno A.
      • Ishikawa M.
      • Sasaki K.
      • Wada K.
      Decrease in pyridoxal-5’-phosphate concentration and increase in pyridoxal concentration in rat plasma by 4’-O-methylpyridoxine administration.
      ).

      Measurement of mitochondrial function

      Cellular respiration (oxygen consumption rate [OCR]) was assessed using an XFp Extracellular Flux Analyzer (Seahorse Bioscience). Cells were cultured in vitamin B2-depleted medium for 4 days. Then, 104 cells per well were incubated in poly-L-lysine-coated wells with vitamin B2-depleted medium (Sigma-Aldrich Inc) or with that supplemented by RF, FAD, or FMN (0.2 μM) for 24 h. The XF Cell Mito Stress Test (Seahorse Bioscience Inc) was used to measure the key parameters of mitochondrial respiration using specific mitochondrial inhibitors and uncouplers: oligomycin (1 μM), carbonyl cyanide p-trifluoromethoxyphenylhydrazone (2 μM), and a mixture of rotenone/antimycin A (both 0.5 μM) were injected sequentially following the manufacturer’s instructions. Before drug addition, basal OCR was measured. Oligomycin was injected to inhibit ATP synthase (complex V), and the OCR was recorded. To determine the maximal respiration, the uncoupler carbonyl cyanide p-trifluoromethoxyphenylhydrazone was injected. Finally, a mixture of rotenone/antimycin A was injected to inhibit the flux of electrons through complexes I and III and to enable calculation of the spare respiratory capacity. Residual O2 consumption shows mitochondria-independent O2 consumption.

      Statistical analysis

      Data are expressed as means ± SD. Statistically significant differences were determined using one-way analysis of variance followed by Tukey post hoc test or Student t test, with p < 0.05 or 0.01 as the criterion. Pearson correlation analysis was performed to analyze correlations. Kinetic analyses were performed using Sigma Plot (Systat Software Inc).

      Data availability

      All data are contained within the manuscript.

      Conflict of interest

      The authors declare that they have no conflicts of interest with the contents of this article.

      Acknowledgments

      We thank Keiko Kinoshita, Saori Umeshita, and Kae Imanishi (Osaka University) for technical help. We thank Edanz (https://jp.edanz.com/ac) for editing a draft of this manuscript.

      Author contributions

      N. S. conceptualization, methodology, validation, formal analysis, investigation, data curation, writing-original draft, and visualization; D. K. conceptualization, methodology, validation, formal analysis, investigation, data curation, writing-original draft, visualization, and project administration; A. I. methodology, validation, formal analysis, investigation, and data curation; K. H. methodology, validation, formal analysis, investigation, and data curation; R. F. methodology and validation; T. K. conceptualization, resources, writing-review and editing, and funding acquisition; N. I. conceptualization and writing-review and editing; N. H. validation, formal analysis, investigation, and writing-review and editing; K. W. conceptualization, methodology, writing-review and editing, and supervision; Y.M. conceptualization, methodology, validation, formal analysis, investigation, resources, data curation, writing-original draft, visualization, project administration, and funding acquisition.

      Funding and additional information

      This work was supported by JSPS and MEXT KAKENHI grants ( JP21H02415 and JP17H06422 to T. K.), a grant from Mizutani Foundation for Glycoscience, KOSE Cosmetology Research Foundation, Ministry of Health, Labour and Welfare ( 20FC1025 ), and a grant from the Practical Research Project for Rare/Intractable Diseases from the Japan Agency for Medical Research and Development ( AMED ) ( 21ek0109418h0003 ) to Y. M.

      References

        • Rindi G.
        • Patrini C.
        • Poloni M.
        Monophosphate, the only phosphoric ester of thiamin in the cerebro-spinal fluid.
        Experientia. 1981; 37: 975-976
        • Hustad S.
        • Ueland P.M.
        • Schneede J.
        Quantification of riboflavin, flavin mononucleotide, and flavin adenine dinucleotide in human plasma by capillary electrophoresis and laser-induced fluorescence detection.
        Clin. Chem. 1999; 45: 862-868
        • Vasilaki A.T.
        • McMillan D.C.
        • Kinsella J.
        • Duncan A.
        • O’Reilly D.S.J.
        • Talwar D.
        Relation between riboflavin, flavin mononucleotide and flavin adenine dinucleotide concentrations in plasma and red cells in patients with critical illness.
        Clin. Chim. Acta. 2010; 411: 1750-1755
        • Talwar D.
        • Quasim T.
        • McMillan D.C.
        • Kinsella J.
        • Williamson C.
        • O’Reilly D.S.J.
        Optimisation and validation of a sensitive high-performance liquid chromatography assay for routine measurement of pyridoxal 5-phosphate in human plasma and red cells using pre-column semicarbazide derivatisation.
        J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 2003; 792: 333-343
        • Ueland P.M.
        • Ulvik A.
        • Rios-Avila L.
        • Midttun O.
        • Gregory J.F.
        Direct and functional biomarkers of vitamin B6 status.
        Annu. Rev. Nutr. 2015; 35: 33-70
        • Akiyama T.
        • Hayashi Y.
        • Hanaoka Y.
        • Shibata T.
        • Akiyama M.
        • Tsuchiya H.
        • et al.
        Pyridoxal 5′-phosphate, pyridoxal, and 4-pyridoxic acid in the paired serum and cerebrospinal fluid of children.
        Clin. Chim. Acta. 2017; 472: 118-122
        • Luong K.V.Q.
        • Nguyen L.T.H.
        Adult hypophosphatasia and a low level of red blood cell thiamine pyrophosphate.
        Ann. Nutr. Metab. 2005; 49: 107-109
        • Millán J.L.
        • Whyte M.P.
        Alkaline phosphatase and hypophosphatasia.
        Calcif Tissue Int. 2016; 98: 398-416
        • Barile M.
        • Giancaspero T.A.
        • Leone P.
        • Galluccio M.
        • Indiveri C.
        Riboflavin transport and metabolism in humans.
        J. Inherit. Metab. Dis. 2016; 39: 545-557
        • Akiyama T.
        • Selhub J.
        • Rosenberg I.H.
        FMN phosphatase and FAD pyrophosphatase in rat intestinal brush borders: role in intestinal absorption of dietary riboflavin.
        J. Nutr. 1982; 112: 263-268
        • Daniel H.
        • Binninger E.
        • Rehner G.
        Hydrolysis of FMN and FAD by alkaline phosphatase of the intestinal brush-border membrane.
        Int. J. Vitam Nutr. Res. 1983; 53: 109-114
        • Said H.M.
        • Arianas P.
        Transport of riboflavin in human intestinal brush border membrane vesicles.
        Gastroenterology. 1991; 100: 82-88
        • Zimmermann H.
        • Zebisch M.
        • Sträter N.
        Cellular function and molecular structure of ecto-nucleotidases.
        Purinergic Signal. 2012; 8: 437-502
        • Millán J.L.
        Alkaline phosphatases.
        Purinergic Signal. 2006; 2: 335-341
        • Okuda J.
        Metabolism of flavin nucleotides. I. Of flavin nucleotides in digestive juice. Decomposition.
        Chem. Pharm. Bull. 1958; 6: 662-665
        • Okuda J.
        Metabolism of flavin nucleotides. II. Decomposition of flavin nucleotides in the small intestine.
        Chem. Pharm. Bull. 1958; 6: 665-669
        • Lee R.S.F.
        • Ford H.C.
        5’-Nucleotidase of human placental trophoblastic microvilli possesses cobalt-stimulated FAD pyrophosphatase activity.
        J. Biol. Chem. 1988; 263: 14878-14883
        • Picher M.
        • Burch L.H.
        • Hirsh A.J.
        • Spychala J.
        • Boucher R.C.
        Ecto 5′-nucleotidase and nonspecific alkaline phosphatase: two AMP-hydrolyzing ectoenzymes with distinct roles in human airways.
        J. Biol. Chem. 2003; 278: 13468-13479
        • Misumi Y.
        • Ogata S.
        • Ohkubo K.
        • Hirose S.
        • Ikehara Y.
        Primary structure of human placental 5′-nucleotidase and identification of the glycolipid anchor in the mature form.
        Eur. J. Biochem. 1990; 191: 563-569
        • Kozlenkov A.
        • le Du M.H.
        • Cuniasse P.
        • Ny T.
        • Hoylaerts M.F.
        • Millán J.L.
        Residues determining the binding specificity of uncompetitive inhibitors to tissue-nonspecific alkaline phosphatase.
        J. Bone Miner Res. 2004; 19: 1862-1872
        • Bhattarai S.
        • Freundlieb M.
        • Pippel J.
        • Meyer A.
        • Abdelrahman A.
        • Fiene A.
        • et al.
        α,β-Methylene-ADP (AOPCP) derivatives and analogues: development of potent and selective ecto-5′-nucleotidase (CD73) inhibitors.
        J. Med. Chem. 2015; 58: 6248-6263
        • Anderson B.B.
        • Fulford-Jones C.E.
        • Child J.A.
        • Beard M.E.
        • Bateman C.J.
        Conversion of vitamin B 6 compounds to active forms in the red blood cell.
        J. Clin. Invest. 1971; 50: 1901-1909
        • Anderson B.B.
        • Saary M.
        • Stephens A.D.
        • Perry G.M.
        • Lersundi I.C.
        • Horn J.E.
        Effect of riboflavin on red-cell metabolism of vitamin B6.
        Nature. 1976; 264: 574-575
        • da Silva V.R.
        • Russell K.A.
        • Gregory J.F.
        Vitamin B6.
        Present Knowledge in Nutrition. 10th Ed. Wiley-Blackwell, Hoboken, New Jersey2012: 307-320
        • Udhayabanu T.
        • Manole A.
        • Rajeshwari M.
        • Varalakshmi P.
        • Houlden H.
        • Ashokkumar B.
        Riboflavin responsive mitochondrial dysfunction in neurodegenerative diseases.
        J. Clin. Med. 2017; 6: 52
        • Akiyama T.
        • Kubota T.
        • Ozono K.
        • Michigami T.
        • Kobayashi D.
        • Takeyari S.
        • et al.
        Pyridoxal 5′-phosphate and related metabolites in hypophosphatasia: effects of enzyme replacement therapy.
        Mol. Genet. Metab. 2018; 125: 174-180
        • Cruz T.
        • Gleizes M.
        • Balayssac S.
        • Mornet E.
        • Marsal G.
        • Millán J.L.
        • et al.
        Identification of altered brain metabolites associated with TNAP activity in a mouse model of hypophosphatasia using untargeted NMR-based metabolomics analysis.
        J. Neurochem. 2017; 140: 919-940
        • Tarailo-Graovac M.
        • Sinclair G.
        • Stockler-Ipsiroglu S.
        • van Allen M.
        • Rozmus J.
        • Shyr C.
        • et al.
        The genotypic and phenotypic spectrum of PIGA deficiency.
        Orphanet J. Rare Dis. 2015; 10: 23
        • Kuwayama R.
        • Suzuki K.
        • Nakamura J.
        • Aizawa E.
        • Yoshioka Y.
        • Ikawa M.
        • et al.
        Establishment of mouse model of inherited PIGO deficiency and therapeutic potential of AAV-based gene therapy.
        Nat. Commun. 2022; 13: 3107
        • Ishida M.
        • Maki Y.
        • Ninomiya A.
        • Takada Y.
        • Campeau P.
        • Kinoshita T.
        • et al.
        Ethanolamine-phosphate on the second mannose is a preferential bridge for some GPI-anchored proteins.
        EMBO Rep. 2022; 23e54352
        • Tremblay-Laganière C.
        • Maroofian R.
        • Nguyen T.T.M.
        • Karimiani E.G.
        • Kirmani S.
        • Akbar F.
        • et al.
        PIGG variant pathogenicity assessment reveals characteristic features within 19 families.
        Genet. Med. 2021; 23: 1873-1881
        • Kuki I.
        • Takahashi Y.
        • Okazaki S.
        • Kawawaki H.
        • Ehara E.
        • Inoue N.
        • et al.
        Vitamin B6-responsive epilepsy due to inherited GPI deficiency.
        Neurology. 2013; 81: 1467-1469
        • Tanigawa J.
        • Nabatame S.
        • Tominaga K.
        • Nishimura Y.
        • Maegaki Y.
        • Kinosita T.
        • et al.
        High-dose pyridoxine treatment for inherited glycosylphosphatidylinositol deficiency.
        Brain Dev. 2021; 43: 680-687
        • Gregory J.F.
        • Ink S.L.
        Identification and quantification of pyridoxine-β-glucoside as a major form of vitamin B6 in plant-derived foods.
        J. Agric. Food Chem. 1987; 35: 76-82
        • Stagg J.
        • Divisekera U.
        • McLaughlin N.
        • Sharkey J.
        • Pommey S.
        • Denoyer D.
        • et al.
        Anti-CD73 antibody therapy inhibits breast tumor growth and metastasis.
        Proc. Natl. Acad. Sci. U. S. A. 2010; 107: 1547-1552
        • Allard B.
        • Longhi M.S.
        • Robson S.C.
        • Stagg J.
        The ectonucleotidases CD39 and CD73: novel checkpoint inhibitor targets.
        Immunol. Rev. 2017; 276: 121-144
        • Wang L.
        • Fan J.
        • Thompson L.F.
        • Zhang Y.
        • Shin T.
        • Curiel T.J.
        • et al.
        CD73 has distinct roles in nonhematopoietic and hematopoietic cells to promote tumor growth in mice.
        J. Clin. Invest. 2011; 121: 2371-2382
        • Akimoto M.
        • Sato Y.
        • Okubo T.
        • Todo H.
        • Hasegawa T.
        • Sugibayashi K.
        Conversion of FAD to FMN and riboflavin in plasma: effects of measuring method.
        Biol. Pharm. Bull. 2006; 29: 1779-1782
        • Coburn S.P.
        • Mahuren J.D.
        • Jain M.
        • Zubovic Y.
        • Wortsman J.
        Alkaline phosphatase (EC 3.1.3.1) in serum is inhibited by physiological concentrations of inorganic phosphate.
        J. Clin. Endocrinol. Metab. 1998; 83: 3951-3957
        • Kobayashi D.
        • Yoshimura T.
        • Johno A.
        • Ishikawa M.
        • Sasaki K.
        • Wada K.
        Decrease in pyridoxal-5’-phosphate concentration and increase in pyridoxal concentration in rat plasma by 4’-O-methylpyridoxine administration.
        Nutr. Res. 2015; 35: 637-642