Advertisement

Correction: CTCF-binding element regulates ESC differentiation via orchestrating long-range chromatin interaction between enhancers and HoxA

Open AccessPublished:November 05, 2022DOI:https://doi.org/10.1016/j.jbc.2022.102653
      The authors report that there were errors in the primer sequences in Supplemental Tables S2 and S3 and provide the revised tables shown below. The authors state that the corrections do not affect the results and conclusions of the article and apologize for any confusion this may have caused.
      Tabled 1
      CRISPR-Cas9 editingSequences (5′-3′)
      CBE+47-KOsgRNA-LCAACAGTTGCTGTACTTGCA
      sgRNA-RCCACATGATGGTGATGTCGA
      ΔE1sgRNA1LTCTCTCTCATTGTTATCTGT
      sgRNA1RACCTATGGACAAACTATTCA
      ΔE2sgRNA2LATATAGCGAGAAAACTACGA
      sgRNA2RCTAAACTCACTTCAAGCGGC
      ΔE3sgRNA3LGGCCTCCCCTTGAGAAATTC
      sgRNA3RTTGGAGGTCACCACAACGTG
      Tabled 1
      Primer namesSequences (5′-3′)
      CBE+47-KOPrimerforwardGCCTGACAAGGTCACAAGACT
      reverseCGGACAGTGAGCTTCCTCAAA
      ΔE1Primer 1forwardGCTCCTTGCTTGCCTTCAAAA
      reverseAGCTGATTGTCTTCCCACCC
      ΔE2Primer 2forwardCGCGCTTTCTATGGCAGAAT
      reverseAAACTTCCAGACTCGGTGGT
      ΔE3Primer 3forwardCCCTCCAGCTTTCTTTAGACCA
      reverseAGCAGACACTGCCCATTTGA

      Linked Article

      • CTCF-binding element regulates ESC differentiation via orchestrating long-range chromatin interaction between enhancers and HoxA
        Journal of Biological ChemistryVol. 296
        • Preview
          Proper expression of Homeobox A cluster genes (HoxA) is essential for embryonic stem cell (ESC) differentiation and individual development. However, mechanisms controlling precise spatiotemporal expression of HoxA during early ESC differentiation remain poorly understood. Herein, we identified a functional CTCF-binding element (CBE+47) closest to the 3'-end of HoxA within the same topologically associated domain (TAD) in ESC. CRISPR-Cas9-mediated deletion of CBE+47 significantly upregulated HoxA expression and enhanced early ESC differentiation induced by retinoic acid (RA) relative to wild-type cells.
        • Full-Text
        • PDF
        Open Access