Advertisement

The interdependent transport of yeast vacuole Ca2+ and H+ and the role of phosphatidylinositol 3,5-bisphosphate

Open AccessPublished:November 02, 2022DOI:https://doi.org/10.1016/j.jbc.2022.102672
      Yeast vacuoles are acidified by the v-type H+-ATPase (V-ATPase) that is comprised of the membrane embedded VO complex and the soluble cytoplasmic V1 complex. The assembly of the V1-VO holoenzyme on the vacuole is stabilized in part through interactions between the VO a-subunit ortholog Vph1 and the lipid phosphatidylinositol 3,5-bisphosphate (PI(3,5)P2). PI(3,5)P2 also affects vacuolar Ca2+ release through the channel Yvc1 and uptake through the Ca2+ pump Pmc1. Here, we asked if H+ and Ca2+ transport activities were connected through PI(3,5)P2. We found that overproduction of PI(3,5)P2 by the hyperactive fab1T2250A mutant augmented vacuole acidification, whereas the kinase-inactive fab1EEE mutant attenuated the formation of a H+ gradient. Separately, we tested the effects of excess Ca2+ on vacuole acidification. Adding micromolar Ca2+ blocked vacuole acidification, whereas chelating Ca2+ accelerated acidification. The effect of adding Ca2+ on acidification was eliminated when the Ca2+/H+ antiporter Vcx1 was absent, indicating that the vacuolar H+ gradient can collapse during Ca2+ stress through Vcx1 activity. This, however, was independent of PI(3,5)P2, suggesting that PI(3,5)P2 plays a role in submicromolar Ca2+ flux but not under Ca2+ shock. To see if the link between Ca2+ and H+ transport was bidirectional, we examined Ca2+ transport when vacuole acidification was inhibited. We found that Ca2+ transport was inhibited by halting V-ATPase activity with Bafilomycin or neutralizing vacuolar pH with chloroquine. Together, these data show that Ca2+ transport and V-ATPase efficacy are connected but not necessarily through PI(3,5)P2.

      Keywords

      Abbreviations:

      AO (acridine orange), CaM (calmodulin), CQ (chloroquine), DMSO (dimethyl sulfoxide), FCCP (carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone), TRP (transient receptor potential), YPD (yeast extract–peptone–dextrose)
      The homeostasis of eukaryotic cells requires the active transport of elements across membranes against concentration gradients. In neurons, action potentials at the presynaptic cleft trigger the influx of Ca2+, which in turn facilitates the fusion of synaptic vesicles with the plasma membrane to release neurotransmitters (
      • Südhof T.C.
      Calcium control of neurotransmitter release.
      ). Other cellular gradients include the accumulation of H+ in the lysosome to acidify the organelle and promote the activity of luminal hydrolases, and the storage of Ca2+ in the endoplasmic reticulum to regulate Ca2+-dependent signaling (
      • Mindell J.A.
      Lysosomal acidification mechanisms.
      ,
      • Daverkausen-Fischer L.
      • Pröls F.
      Regulation of calcium homeostasis and flux between the endoplasmic reticulum and the cytosol.
      ).
      In Saccharomyces cerevisiae, H+ and Ca2+ ions are oppositely transported across the plasma membrane by the P2 type H+-ATPase Pma1 and voltage-gated Ca2+ channel Cch1/Mid1, respectively (
      • Ariño J.
      • Ramos J.
      • Sychrova H.
      Monovalent cation transporters at the plasma membrane in yeasts.
      ,
      • Locke E.G.
      • Bonilla M.
      • Liang L.
      • Takita Y.
      • Cunningham K.W.
      A homolog of voltage-gated Ca(2+) channels stimulated by depletion of secretory Ca(2+) in yeast.
      ). The yeast vacuole differs from the plasma membrane in that the organelle uses ATP hydrolysis to pump both H+ and Ca2+ ions into the vacuole lumen. The V-ATPase pumps H+ into the vacuole, while Ca2+ is transported by the Ca2+-ATPase Pmc1. Ca2+ is also taken into the vacuole lumen through the Ca2+/H+ (K+/H+) antiporter Vcx1 (
      • Cunningham K.W.
      • Fink G.R.
      Calcineurin-dependent growth control in Saccharomyces cerevisiae mutants lacking PMC1, a homolog of plasma membrane Ca2+ ATPases.
      ,
      • Cunningham K.W.
      • Fink G.R.
      Calcineurin inhibits VCX1-dependent H+/Ca2+ exchange and induces Ca2+ ATPases in Saccharomyces cerevisiae.
      ,
      • Miseta A.
      • Kellermayer R.
      • Aiello D.P.
      • Fu L.
      • Bedwell D.M.
      The vacuolar Ca2+/H+ exchanger Vcx1p/Hum1p tightly controls cytosolic Ca2+ levels in S. cerevisiae.
      ). Vacuoles can rapidly take up Ca2+ after high cellular uptake under stress conditions and can store Ca2+ at micromolar concentrations, most of which is bound to inorganic polyphosphate while a smaller pool is subject to further transport (
      • Dunn T.
      • Gable K.
      • Beeler T.
      Regulation of cellular Ca2+ by yeast vacuoles.
      ,
      • Halachmi D.
      • Eilam Y.
      Cytosolic and vacuolar Ca2+ concentrations in yeast cells measured with the Ca2+-sensitive fluorescence dye indo-1.
      ). During osmotic shock, Ca2+ is released from the vacuole through the transient receptor potential (TRP) channel ortholog Yvc1, leading to vacuole fission/fragmentation (
      • Dong X.
      • Shen D.
      • Wang X.
      • Dawson T.
      • Li X.
      • Zhang Q.
      • et al.
      PI(3,5)P(2) controls membrane trafficking by direct activation of mucolipin Ca(2+) release channels in the endolysosome.
      ). This activity requires the phosphatidylinositol 3-phosphate (PI3P) 5-kinase Fab1 and the production of PI(3,5)P2, which is also linked to vacuole size and fragmentation (
      • Gary J.D.
      • Wurmser A.E.
      • Bonangelino C.J.
      • Weisman L.S.
      • Emr S.D.
      Fab1p is essential for PtdIns(3)P 5-kinase activity and the maintenance of vacuolar size and membrane homeostasis.
      ,
      • Bonangelino C.J.
      • Catlett N.L.
      • Weisman L.S.
      Vac7p, a novel vacuolar protein, is required for normal vacuole inheritance and morphology.
      ). Under isotonic conditions, Ca2+ efflux occurs during vacuole fusion upon the formation of trans-SNARE complexes through a Yvc1-independent mechanism (
      • Merz A.J.
      • Wickner W.T.
      Trans-SNARE interactions elicit Ca2+ efflux from the yeast vacuole lumen.
      ). Unlike the fission pathway, vacuole fusion is inhibited by the overproduction of PI(3,5)P2 that is linked to the inhibition of net Ca2+ efflux (
      • Miner G.E.
      • Sullivan K.D.
      • Guo A.
      • Jones B.C.
      • Hurst L.R.
      • Ellis E.C.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates the transition between trans-SNARE complex formation and vacuole membrane fusion.
      ,
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). PI(3,5)P2 lowers the observed net Ca2+ efflux through its activity on Pmc1. Taken together, it is likely that Fab1 activity serves as a switch that promotes fission while inhibiting fusion through its effects on Ca2+ transport.
      The regulatory functions of Fab1 activity are not limited to Ca2+ transport and the fission/fusion switch. PI(3,5)P2 also affects V-ATPase activity through direct physical interactions with the VO subunit Vph1 (
      • Banerjee S.
      • Clapp K.
      • Tarsio M.
      • Kane P.M.
      Interaction of the late endo-lysosomal lipid PI(3,5)P2 with the Vph1 isoform of yeast V-ATPase increases its activity and cellular stress tolerance.
      ,
      • Li S.C.
      • Diakov T.T.
      • Xu T.
      • Tarsio M.
      • Zhu W.
      • Couoh-Cardel S.
      • et al.
      The signaling lipid PI(3,5)P₂ stabilizes V₁-V(o) sector interactions and activates the V-ATPase.
      ). Vph1 is also found in a complex with Pmc1 and the R-SNARE Nyv1 that is sensitive to PI(3,5)P2 concentrations (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). The interaction between Vph1 and PI(3,5)P2 stabilizes the assembly of V1-Vo holocomplex to form the active V-ATPase. In the Golgi, Stv1 takes the place of Vph1 and interacts with the compartment rich lipid PI4P instead of PI(3,5)P2, which is only made on late endosomes and lysosomes (
      • Banerjee S.
      • Kane P.M.
      Direct interaction of the Golgi V-ATPase a-subunit isoform with PI(4)P drives localization of Golgi V-ATPases in yeast.
      ). In both instances, specific phosphoinositides are essential for V-ATPase function.
      The effects of PI(3,5)P2 on both V-ATPase function and Ca2+ transport suggest that these transport mechanisms could be interdependent. This notion is consistent with previous reports showing that inhibiting V-ATPase activity blocks the ability of Vcx1 to detoxify the cytoplasm after an increase in Ca2+ (
      • Forster C.
      • Kane P.M.
      Cytosolic Ca2+ homeostasis is a constitutive function of the V-ATPase in Saccharomyces cerevisiae.
      ). Others have shown that the uptake of 500 μM 45Ca2+ is sensitive to ionophores such as CCCP and Nigericin (
      • Ohsumi Y.
      • Anraku Y.
      Calcium transport driven by a proton motive force in vacuolar membrane vesicles of Saccharomyces cerevisiae.
      ).
      In this study, we examined the role of PI(3,5)P2 on H+ transport and how H+ and Ca2+ transport affect each other. We demonstrate that PI(3,5)P2 overproduction augments vacuole acidification while the lack of the lipid reduces acidification. We also show that increasing extraluminal Ca2+ concentrations blocked vacuole acidification in a manner linked to Vcx1, while chelating Ca2+ accelerated acidification. Finally, we show that a fully functioning V-ATPase is needed for Ca2+ efflux. Together, this study shows that the transport of H+ and Ca2+ is interdependent and can be affected by the PI(3,5)P2 composition of the membrane.

      Results

      Proton influx is modulated by Fab1 activity

      Others have shown that adding exogenous short chain dioctanoyl (C8) PI(3,5)P2 to purified yeast vacuoles augmented acidification (
      • Banerjee S.
      • Clapp K.
      • Tarsio M.
      • Kane P.M.
      Interaction of the late endo-lysosomal lipid PI(3,5)P2 with the Vph1 isoform of yeast V-ATPase increases its activity and cellular stress tolerance.
      ). This was proposed to be due in part to the ability of PI(3,5)P2 to stabilize the V1–VO holocomplex, through the interactions of the VO subunit Vph1 and this lipid (
      • Li S.C.
      • Diakov T.T.
      • Xu T.
      • Tarsio M.
      • Zhu W.
      • Couoh-Cardel S.
      • et al.
      The signaling lipid PI(3,5)P₂ stabilizes V₁-V(o) sector interactions and activates the V-ATPase.
      ). However, the effect of adding C8-PI(3,5)P2 on stabilizing the V1–VO complex has not been shown directly. Our previous work showed that elevating concentrations of PI(3,5)P2 inhibited vacuole fusion (
      • Miner G.E.
      • Sullivan K.D.
      • Guo A.
      • Jones B.C.
      • Hurst L.R.
      • Ellis E.C.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates the transition between trans-SNARE complex formation and vacuole membrane fusion.
      ). This was later linked to the ability of PI(3,5)P2 levels to affect Ca2+ transport across the vacuolar membrane (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). Based on these findings, we hypothesized that PI(3,5)P2 may affect V-ATPase activity through modulating Ca2+ efflux from the vacuole lumen.
      To test our hypothesis, we started by recapitulating the published results using C8-PI(3,5)P2 and other C8 lipids and found that C8-PI(3,5)P2 indeed enhanced acidification as measured by changes in acridine orange (AO) fluorescence; however, the changes were modest in our hands (not shown). This prompted us to ask whether changing endogenous production of the lipid would have a stronger effect. To do this, we performed AO fluorescence assays with vacuoles isolated from WT yeast as well as strains expressing the kinase-deficient fab1EEE or the hyperactive fab1T2250A mutations (
      • Li S.C.
      • Diakov T.T.
      • Xu T.
      • Tarsio M.
      • Zhu W.
      • Couoh-Cardel S.
      • et al.
      The signaling lipid PI(3,5)P₂ stabilizes V₁-V(o) sector interactions and activates the V-ATPase.
      ,
      • Lang M.J.
      • Strunk B.S.
      • Azad N.
      • Petersen J.L.
      • Weisman L.S.
      An intramolecular interaction within the lipid kinase Fab1 regulates cellular phosphatidylinositol 3,5-bisphosphate lipid levels.
      ). AO fluorescence is reduced at 520 nm in acidic environments while increasing in fluorescence a 680 nm (
      • Thomé M.P.
      • Filippi-Chiela E.C.
      • Villodre E.S.
      • Migliavaca C.B.
      • Onzi G.R.
      • Felipe K.B.
      • et al.
      Ratiometric analysis of Acridine Orange staining in the study of acidic organelles and autophagy.
      ,
      • Damas-Souza D.M.
      • Nunes R.
      • Carvalho H.F.
      An improved acridine orange staining of DNA/RNA.
      ). Thus, the red-spectral shift in AO fluorescence serves as a measure of vacuole acidification. Vacuoles were incubated with AO for 600 s to allow acidification to plateau. Carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone (FCCP) was added after 600 s to collapse the proton gradient and show that the change in AO fluorescence was due to active ATP-dependent transport and not passive transport of the dye (
      • Nelson N.
      The vacuolar H(+)-ATPase--one of the most fundamental ion pumps in nature.
      ). In Figure 1, A and B, we show that the overproduction of PI(3,5)P2 by fab1T2250A led to a pronounced increase in acidification, as manifested by an augmented drop in AO fluorescence. To show that the increased H+ transport activity by fab1T2250A vacuoles was indeed due to the overproduction of PI(3,5)P2, we added the PIKfyve/Fab1 inhibitor apilimod to reactions containing fab1T2250A vacuoles (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ,
      • Cai X.
      • Xu Y.
      • Cheung A.K.
      • Tomlinson R.C.
      • Alcázar-Román A.
      • Murphy L.
      • et al.
      PIKfyve, a class III PI kinase, is the target of the small molecular IL-12/IL-23 inhibitor apilimod and a player in Toll-like receptor signaling.
      ,
      • Dayam R.M.
      • Saric A.
      • Shilliday R.E.
      • Botelho R.J.
      The phosphoinositide-gated lysosomal Ca(2+) channel, TRPML1, is required for phagosome maturation.
      ). We found that apilimod restored fab1T2250A vacuole acidification to WT levels (Fig. 1B). Previously, we showed elevated levels of PI(3,5)P2, whether added exogenously as C8-PI(3,5)P2 or overproduce by fab1T2250A led to prolonged Ca2+ uptake by Pmc1 (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). Importantly, we found that adding apilimod reversed the effect of overproducing PI(3,5)P2 by fab1T2250A to WT levels. Together with the current data, it suggests that PI(3,5)P2 may link Ca2+ and H+ transport on the yeast vacuole.
      Figure thumbnail gr1
      Figure 1Modifying PI(3,5)P2 levels alters vacuole acidification. Vacuoles were used for vacuole acidification measured by AO fluorescence. Reactions were incubated with or without ATP-regenerating system added at 30 s and incubated for a total of 600 s, at which point FCCP was added to equilibrate the H+ gradient. AO fluorescence was normalized to the initial value set to 1. A, WT and fab1T2250A vacuoles were compared in their efficiency to acidify vacuoles. In parallel, fab1T2250A vacuoles were incubated in the presence of 125 μM apilimod. B, quantitation of multiple experiments in panel (A) showed a significant effect of expressing fab1T2250A compared to WT [F(2,15) = 36; ∗∗∗∗p < 0.0001] (One way ANOVA for multiple comparisons). Error bars are mean ± SD. Tukey’s multiple comparison test was used for individual p values. (n ≥ 4). C, WT and fab1EEE vacuoles were compared in their acidification efficiency. Separately, fab1EEE vacuoles were incubated in C8-PI(3,5)P2. D, quantitation of multiple experiments in panel (C) showed a significant effect of expressing fab1EEE compared to WT [F(2,17) = 62.05; ∗∗∗∗p < 0.0001] (One way ANOVA for multiple comparisons). Error bars are mean ± SD. Tukey’s multiple comparison test was used for individual p values (n ≥ 4). E, WT, fab1T2250A, and fab1EEE cells were stained with quinacrine to label acidified compartments. FM4-64 was used to stain the vacuole membrane and Calcofluor (Calc.) White was used to stain the cell wall. The scale bar represents 5 μm. AO, acridine orange; FCCP, carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone.
      While the increase in PI(3,5)P2 led to enhanced acidification, we next asked if the lack of PI(3,5)P2 would prevent the spectral shift AO fluorescence. To test this, we used vacuoles harboring the kinase-deficient fab1EEE mutant (
      • Duex J.E.
      • Tang F.
      • Weisman L.S.
      The Vac14p-Fig4p complex acts independently of Vac7p and couples PI3,5P2 synthesis and turnover.
      ). This showed that fab1EEE vacuoles had attenuated vacuole acidification (Fig. 1, C and D), which is in keeping with the destabilization of the V1–VO complex when PI(3,5)P2 is absent (
      • Lang M.J.
      • Strunk B.S.
      • Azad N.
      • Petersen J.L.
      • Weisman L.S.
      An intramolecular interaction within the lipid kinase Fab1 regulates cellular phosphatidylinositol 3,5-bisphosphate lipid levels.
      ). That said, enough V1–VO remained on the vacuole to partially acidify the vacuole lumen. To verify if the difference was due to the absence of PI(3,5)P2, we supplemented the reaction with C8-PI(3,5)P2. Curiously, our data showed that supplementing fab1EEE vacuoles with C8-PI(3,5)P2 did not restore acidification (Fig. 1D). In contrast, adding C8-PI(3,5)P2 to WT vacuoles did augment acidification as shown by the Kane lab (
      • Banerjee S.
      • Clapp K.
      • Tarsio M.
      • Kane P.M.
      Interaction of the late endo-lysosomal lipid PI(3,5)P2 with the Vph1 isoform of yeast V-ATPase increases its activity and cellular stress tolerance.
      ). The inability to rescue acidification does not mean that the lipid has no effect on fab1EEE vacuoles. In other studies, we have shown that C8-PI(3,5)P2 restored Ca2+ transport by fab1EEE vacuoles to WT levels (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). The lack of an effect could be multifactorial. The simplest answer is that C8-PI(3,5)P2 restored Ca2+ transport by fab1EEE vacuoles due to reestablishing on-site interactions of factors present after vacuole isolation, whereas the lack of an effect on AO fluorescence could reflect the absence of a factor that required PI(3,5)P2 in vivo prior to vacuole isolation. For instance, we have shown that fab1EEE vacuoles have diminished levels of the ABC transporter Ycf1, which interacts with the V1 subunit Vma10 (
      • Miner G.E.
      • Sullivan K.D.
      • Guo A.
      • Jones B.C.
      • Hurst L.R.
      • Ellis E.C.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates the transition between trans-SNARE complex formation and vacuole membrane fusion.
      ,
      • Snider J.
      • Hanif A.
      • Lee M.E.
      • Jin K.
      • Yu A.R.
      • Graham C.
      • et al.
      Mapping the functional yeast ABC transporter interactome.
      ). While this interaction has not been tested for its effects on V-ATPase efficiency, it serves to illustrate that a more complex network of interactions could be linked to the observed phenotype. In addition, mass spectrometry analysis of fab1EEE vacuoles showed that they contained more of the polyphosphate synthase Vtc4 (not shown) (
      • Müller O.
      • Neumann H.
      • Bayer M.J.
      • Mayer A.
      Role of the Vtc proteins in V-ATPase stability and membrane trafficking.
      ). Deletion of VTC4 inhibits V-ATPase activity; however, overproduction has not been tested on vacuole acidification. Finally, others have shown that PI(3,5)P2 can activate TORC1 and its phosphorylation of the kinase Sch9, which in turn affects the assembly and function of V-ATPases (
      • Deprez M.-A.
      • Maertens J.M.
      • Olsson L.
      • Bettiga M.
      • Winderickx J.
      The role of Sch9 and the V-ATPase in the adaptation response to acetic acid and the consequences for growth and chronological lifespan.
      ,
      • Deprez M.-A.
      • Eskes E.
      • Wilms T.
      • Ludovico P.
      • Winderickx J.
      pH homeostasis links the nutrient sensing PKA/TORC1/Sch9 ménage-à-trois to stress tolerance and longevity.
      ,
      • Wilms T.
      • Swinnen E.
      • Eskes E.
      • Dolz-Edo L.
      • Uwineza A.
      • Van Essche R.
      • et al.
      The yeast protein kinase Sch9 adjusts V-ATPase assembly/disassembly to control pH homeostasis and longevity in response to glucose availability.
      ,
      • Chen Z.
      • Malia P.C.
      • Hatakeyama R.
      • Nicastro R.
      • Hu Z.
      • Péli-Gulli M.-P.
      • et al.
      TORC1 determines Fab1 lipid kinase function at signaling endosomes and vacuoles.
      ). Thus, it is possible that fab1EEE vacuoles have faulty Sch9 function that can alter vacuole acidification in a way that cannot be restored in vitro by the addition of C8-PI(3,5)P2. Nevertheless, it is evident that modulating endogenous PI(3,5)P2 production can augment or dampen vacuole acidification. The lack of a complete inhibition of proton pumping by fab1EEE vacuoles is in accord with a study showing that fab1Δ vacuoles were able to acidify as measured with cDCFDA [5-(and-6)-carboxy-2′,7′-dichlorofluorescein diacetate], an esterase dye that is pH sensitive, and pHluorin fluorescence (
      • Ho C.Y.
      • Choy C.H.
      • Wattson C.A.
      • Johnson D.E.
      • Botelho R.J.
      The Fab1/PIKfyve phosphoinositide phosphate kinase is not necessary to maintain the pH of lysosomes and of the yeast vacuole.
      ). On the other hand, the original work looking at fab1Δ found that the deletion lead to a rise in vacuolar pH from 6 to 7 (
      • Yamamoto A.
      • DeWald D.B.
      • Boronenkov I.V.
      • Anderson R.A.
      • Emr S.D.
      • Koshland D.
      Novel PI(4)P 5-kinase homologue, Fab1p, essential for normal vacuole function and morphology in yeast.
      ). Still, others have found that phagosomes that lack Fab1 are not acidified, leading to reduced proteolysis, immature Cathepsin D, and inhibited bacterial killing (
      • Buckley C.M.
      • Heath V.L.
      • Guého A.
      • Bosmani C.
      • Knobloch P.
      • Sikakana P.
      • et al.
      PIKfyve/Fab1 is required for efficient V-ATPase and hydrolase delivery to phagosomes, phagosomal killing, and restriction of Legionella infection.
      ).
      To confirm the effects of expressing fab1 mutants on vacuole acidification, we looked at whole cells stained with FM4-64 to label the vacuole and quinacrine to label acidified compartments. Calcofluor White was used to stain the cell walls. As shown in Figure 1E, the vacuoles of WT cells stained brightly with quinacrine. In comparison, cells expressing fab1EEE only lightly stained with quinacrine, further indicating that cells lacking PI(3,5)P2 are defective in vacuole acidification. The reduction in quinacrine fluorescence in fab1EEE relative to WT was starker that what was seen with AO fluorescence, suggesting that tracking AO fluorescence using a plate reader was more sensitive compared to quinacrine and fluorescence microscopy. Finally, we found that fab1T2250A vacuoles stained more brightly compared to WT, which was indicative of augmented acidification and agreed with what was seen with AO fluorescence. While examining fab1EEE is informative, the remainder of the study focuses on the overproduction of PI(3,5)P2 by fab1T2250A.

      Sequestering PI(3,5)P2 affects vacuole acidification

      In Figure 1, we showed that fab1 mutations affected vacuole acidification; however, it was unclear whether PI(3,5)P2 was directly involved. To test this, we sequestered PI(3,5)P2 with a specific lipid binding protein. We used the N terminus (ML1N) of the endolysosomal TRP Mucolipin-1/TRPML1 Ca2+ channel (
      • Dong X.
      • Shen D.
      • Wang X.
      • Dawson T.
      • Li X.
      • Zhang Q.
      • et al.
      PI(3,5)P(2) controls membrane trafficking by direct activation of mucolipin Ca(2+) release channels in the endolysosome.
      ). ML1N binds to vacuolar PI(3,5)P2 and inhibits vacuole fusion (
      • Miner G.E.
      • Sullivan K.D.
      • Guo A.
      • Jones B.C.
      • Hurst L.R.
      • Ellis E.C.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates the transition between trans-SNARE complex formation and vacuole membrane fusion.
      ). Here, we found GST-ML1N reduced the spectral shift of AO fluorescence, indicating that vacuole acidification was blocked by sequestering PI(3,5)P2 (Fig. 2, A and B). As a control, we used FYVE domain to bind PI3P at concentrations that inhibit vacuole fusion (
      • Gillooly D.J.
      • Morrow I.C.
      • Lindsay M.
      • Gould R.
      • Bryant N.J.
      • Gaullier J.M.
      • et al.
      Localization of phosphatidylinositol 3-phosphate in yeast and mammalian cells.
      ,
      • Fratti R.A.
      • Jun Y.
      • Merz A.J.
      • Margolis N.
      • Wickner W.
      Interdependent assembly of specific regulatory lipids and membrane fusion proteins into the vertex ring domain of docked vacuoles.
      ,
      • Boeddinghaus C.
      • Merz A.J.
      • Laage R.
      • Ungermann C.
      A cycle of Vam7p release from and PtdIns 3-P-dependent rebinding to the yeast vacuole is required for homotypic vacuole fusion.
      ). Adding FYVE domain had no effect on AO fluorescence, showing binding PI3P does not alter vacuole acidification (Fig. 2, C and D). We have also used the PI4P binding PH domain from FAPP1 at concentrations that inhibit vacuole fusion and saw no effect on acidification (
      • Zhang C.
      • Balutowski A.
      • Feng Y.
      • Calderin J.D.
      • Fratti R.A.
      High throughput analysis of vacuolar acidification.
      ,
      • Weixel K.M.
      • Blumental-Perry A.
      • Watkins S.C.
      • Aridor M.
      • Weisz O.A.
      Distinct Golgi populations of phosphatidylinositol 4-phosphate regulated by phosphatidylinositol 4-kinases.
      ,
      • Stroupe C.
      • Collins K.M.
      • Fratti R.A.
      • Wickner W.
      Purification of active HOPS complex reveals its affinities for phosphoinositides and the SNARE Vam7p.
      ,
      • Karunakaran S.
      • Fratti R.A.
      The lipid composition and physical properties of the yeast vacuole affect the hemifusion-fusion transition.
      ). This underscores the importance of free PI(3,5)P2 in vacuole acidification.
      Figure thumbnail gr2
      Figure 2Sequestering or producing PI(3,5)P2 inhibits vacuole acidification. A, WT vacuoles were incubated with a dose curve of the PI(3,5)P2 binding domain GST-ML1N and AO fluorescence was measured. B, quantitation of multiple experiments in panel (A) showed a significant effect of treating reactions with ML1N [F(2,9) = 44.48; ∗∗∗∗p < 0.0001] (One way ANOVA for multiple comparisons with no treatment (0 μM) as a control). Error bars are mean ± SD. Dunnett multiple comparison test was used for individual p values (n = 4). ∗p < 0.05, ∗∗∗∗p < 0.001. C, WT type vacuoles were incubated with GST-FYVE and AO quenching was measured. D, average of multiple experiments in panel (C). E, vacuoles were treated with 125 μM apilimod, 250 μM verapamil, or DMSO (solvent) in the presence of AO at the beginning of the reaction. AO fluorescence was measured for 250 s and FCCP was added seconds to collapse the H+ gradient (arrow). F, quantitation of multiple experiments in panel (E) showed a significant effect of treating reactions with apilimod and verapamil [F(6,14) = 56.02; ∗∗∗∗p < 0.0001] (One way ANOVA for multiple comparisons with no treatment (0 μM) as a control). Error bars are mean ± SD. Dunnett multiple comparison test was used for individual p values (n = 3). ∗∗∗∗p < 0.001. G, effect of late additions of 125 μM apilimod, 250 μM verapamil, 100 nM bafilomycin, and DMSO on H+ transport (arrow, Inhibitor) added at 350 s. FCCP was added at 720 s to collapse the H+ gradient (arrow, FCCP). H, quantitation of multiple experiments in panel (G) showed a significant effect of treating reactions with bafilomycin, apilimod, and verapamil [F(4,10) = 65.72; ∗∗∗∗p < 0.0001] (One way ANOVA for multiple comparisons with no treatment (Late PS) as a control). Error bars are mean ± SD. Dunnett multiple comparison test was used for individual p values (n = 3). ∗∗∗∗p < 0.001. AO, acridine orange; DMSO, dimethyl sulfoxide; FCCP, carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone.

      Fab1 activity links vacuole acidification to Ca2+ transport

      In the results aforementioned, we used Fab1 mutations to examine the effects of PI(3,5)P2 production during AO fluorescence experiments. To test if inhibiting Fab1 on WT vacuoles would have similar effects, we used the Fab1 inhibitor apilimod. We have previously shown that apilimod inhibits PI(3,5)P2 production by Fab1 on isolated vacuoles (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). Here, we found that adding apilimod at the start of the reaction completely blocked the spectral shift in AO fluorescence, suggesting that inhibiting PI(3,5)P2 production had inhibited vacuole acidification (Fig. 2, E and F). The dimethyl sulfoxide (DMSO) treatment had no effect, showing that the effect of apilimod was not due to its solvent.
      Due to the effects of apilimod, we asked if Ca2+ transport directly affected vacuole acidification. Isolated vacuoles rapidly take up Ca2+ from the medium upon adding ATP, after which they release Ca2+ during the docking stage of fusion in a SNARE-dependent manner (
      • Merz A.J.
      • Wickner W.T.
      Trans-SNARE interactions elicit Ca2+ efflux from the yeast vacuole lumen.
      ). The take up of Ca2+ can be inhibited by compounds that target Ca-ATPase pumps. In a previous study, we found that the Ca2+ pump inhibitor verapamil blocked Ca2+ uptake when added at the start of the assay, suggesting that the sole vacuolar Ca-ATPase pump Pmc1 was inhibited (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). This indicated that the Pmc1 is the primary mechanism for Ca2+ uptake since the Ca2+/H+ antiporter does not use ATP. This was further supported by inhibition of Ca2+ uptake by verapamil on vcx1Δ vacuoles. Vacuole acidification was also blocked by the Ca-ATPase inhibitors cyclopiazonic acid and prenylamine (
      • Shmigol A.V.
      • Eisner D.A.
      • Wray S.
      The role of the sarcoplasmic reticulum as a Ca2+ sink in rat uterine smooth muscle cells.
      ,
      • Sorin A.
      • Rosas G.
      • Rao R.
      PMR1, a Ca2+-ATPase in yeast Golgi, has properties distinct from sarco/endoplasmic reticulum and plasma membrane calcium pumps.
      ,
      • Lamers J.M.
      • Cysouw K.J.
      • Verdouw P.D.
      Slow calcium channel blockers and calmodulin. Effect of felodipine, nifedipine, prenylamine and bepridil on cardiac sarcolemmal calcium pumping ATPase.
      ) (not shown).
      Knowing the effects of verapamil on Ca2+, we asked if vacuole acidification would be affected in a similar manner. When we added verapamil to AO fluorescence assays at the start of the experiment, we observed a complete block in acidification (Fig. 2, E and F). Because these treatments also inhibited the uptake of Ca2+, it suggested that maintaining elevated extraluminal Ca2+ could inhibit vacuole acidification (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). It further suggests that the effects of PI(3,5)P2 on vacuole acidification could be linked to modulating Ca2+ transport.

      Inhibiting PI(3,5)P2 production and blocking Ca2+ transport disrupts vacuolar H+ gradients

      Previously, we found that apilimod added after 10 min of Ca2+ uptake led to a halt in uptake followed by an efflux of Ca2+ (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). This indicated that Fab1 continued to be active and that PI(3,5)P2 was required for normal Ca2+ transport across the vacuole membrane. Here, we asked whether Fab1 activity was also required for maintaining an acidified lumen. To test this, we added apilimod after 300 s when AO quenching had plateaued upon forming a stable H+ gradient of acidification. We found that AO fluorescence at 520 nm rapidly increased upon adding apilimod, indicating that vacuole acidification was no longer maintained (Fig. 2, G and H). Adding DMSO had no effect on vacuole acidification, indicating that the effect was due to apilimod. Similarly, adding verapamil at 300 s led to a rapid deacidification. Prenylamine has similar effect (not shown). The loss of the H+ gradient was consistent with the rapid release of Ca2+ when vacuoles were treated with verapamil after 600 s of incubation (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). The effects of apilimod and verapamil were not due to leakage/lysis as these reagents do not inhibit vacuoles from fusing (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). Verapamil and others inhibitor of Ca2+ transport including nicardipine, terodiline, and diltiazem also block the formation of H+ gradients produced by V-ATPase activity in catecholamine storage vesicles, indicating that a Ca2+ gradient was needed for vesicle acidification (
      • Terland O.
      • Grønberg M.
      • Flatmark T.
      The effect of calcium channel blockers on the H(+)-ATPase and bioenergetics of catecholamine storage vesicles.
      ). Together, these data bolster the idea that PI(3,5)P2, Ca2+ transport, and vacuole acidification are part of a regulatory circuit. As a control, we used bafilomycin to block V-ATPase activity. This led to the deacidification of the vacuoles, indicating that the H+ gradient must be constantly maintained through V-ATPase activity.

      Ca2+ affects V-ATPase activity

      Based on the effects of apilimod and verapamil on vacuole acidification and Ca2+ transport, we asked whether the direct addition or sequestration of Ca2+ would affect vacuole acidification. Others have shown that adding Ca2+ at millimolar levels inhibited the fusion WT vacuoles while vcx1Δ/pmc1Δ or vcx1Δ vacuoles were resistant (
      • Ungermann C.
      • Wickner W.
      • Xu Z.
      Vacuole acidification is required for trans-SNARE pairing, LMA1 release, and homotypic fusion.
      ). That study also showed that while WT vacuoles accumulated quinacrine at a reduced rate in the presence of Ca2+, the vcx1Δ/pmc1Δ vacuoles took up quinacrine at untreated WT levels. The resistance to Ca2+ was attributed to Vcx1 function and suggests that high Ca2+ levels need to enter vacuoles to prevent fusion and acidification. Their experiments used quinacrine to measure acidification in an endpoint assay. This approach misses the dynamics of acidification and could miss changes in kinetics even if the endpoint is the same. As shown previously, quinacrine is likely to miss small changes in acidification.
      To test the connection between PI(3,5)P2, Ca2+, and vacuole acidification, we needed to see how Ca2+ affected AO fluorescence. First, we performed AO fluorescence assays with isolated vacuoles incubated with a dosage curve of CaCl2. This showed that Ca2+ inhibited vacuole acidification in a dose-dependent manner at micromolar levels (Fig. 3, A and B). Full inhibition of acidification occurred with 250 μM Ca2+, which was nearly 10-fold less that what was has been shown to inhibit fusion (
      • Ungermann C.
      • Wickner W.
      • Xu Z.
      Vacuole acidification is required for trans-SNARE pairing, LMA1 release, and homotypic fusion.
      ). To verify the effects of Ca2+ on vacuole acidification, we used fluorescence microscopy and quinacrine staining of whole cells (
      • Flannery A.R.
      • Graham L.A.
      • Stevens T.H.
      Topological characterization of the c, c’, and c’’ subunits of the vacuolar ATPase from the yeast Saccharomyces cerevisiae.
      ,
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Hurst L.R.
      • Starr M.L.
      • Rivera-Kohr D.A.
      • et al.
      Copper blocks V-ATPase activity and SNARE complex formation to inhibit yeast vacuole fusion.
      ). As expected, untreated cells accumulated quinacrine in their vacuoles and fluoresced strongly (Fig. 3C). When cells were incubated with CaCl2, we observed that quinacrine staining was blocked. This is in accord with the AO fluorescence data in Figure 3, A and B.
      Figure thumbnail gr3
      Figure 3Ca2+ level modulation alters acidification. A, AO fluorescence assays were performed in the presence of a dosage curve of CaCl2 at the indicated concentrations or PS buffer added at the start of the reactions. A separate reaction omitted ATP. Reactions were incubated for 240 s, after which FCCP was added (arrow). AO fluorescence was normalized to the initial value set to 1. B, average of multiple experiments showing the effects of Ca2+ on AO fluorescence. C, log-phase BJ3505 cells were incubated with 200 μM quinacrine and 2 μM FM4-64 for with or without CaCl2 for 1 h. Cell walls were stained with Calcofluor White. The scale bar represents 5 μm. D, vacuoles were incubated for 300 s at which point a curve of Ca2+ was added and further incubated for a total of 700 s before addition of FCCP. E, average of AO fluorescence when treated with 250 μM Ca2+ or buffer alone. Error bars represent mean ± SD. (n = 6). Data was analyzed using a Student’s unpaired two-tailed t test ∗∗∗∗p < 0.0001. F, vacuole acidification in the presence of a dosage curve of EGTA or PS buffer. G, average of multiple experiments showing the effect EGTA on acidification. H, AO fluorescence reactions were incubated for 300 s, after which a concentration curve EGTA was added and further incubated for a total of 700 s before adding FCCP. AO, acridine orange; FCCP, carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone.
      After determining that adding excess Ca2+ inhibited vacuole acidification, we also tested if it affected vacuole acidification after the H+ gradient has been established. To answer this, we added a dosage curve of Ca2+ after 300 s of incubation, which is enough time to acidify vacuoles. This showed a dose-dependent deacidification of vacuoles as shown by an increase in AO fluorescence at 520 nm (Fig. 3, D and E). This suggests one of two possibilities. First, it could be that the addition of Ca2+ at this point in the assay uses the antiporter activity of Vcx1, which would expel H+ as it takes up the newly added Ca2+. Alternatively, it could indicate that the added Ca2+ altered V-ATPase efficiency, resulting in the accumulation of extraluminal H+ (Fig. 3E). This was similar to findings by Cagnac et al.; however, they added bafilomycin A1 before adding Ca2+, preventing a direct comparison (
      • Cagnac O.
      • Aranda-Sicilia M.N.
      • Leterrier M.
      • Rodriguez-Rosales M.-P.
      • Venema K.
      Vacuolar cation/H+ antiporters of Saccharomyces cerevisiae.
      ). It should be noted that AO fluorescence was restored when 250 μM Ca2+ was added late in the reaction (Fig. 3E), while addition at the beginning prevented the fluorescence shift of AO for the duration of the experiment (Fig. 3A). This suggests that once vacuoles have established a H+ gradient equilibrium, they are able to quickly recover from the Ca2+ spike and reestablish the H+ gradient.
      The role of a Ca2+ gradient in vacuole acidification could also be tested by chelating extraluminal Ca2+ with EGTA. This would make a near instant gradient of free lumenal Ca2+ without the need of Pmc1 or Vcx1 function and accelerate vacuole acidification. As hypothesized, we found that EGTA enhanced the rate of acidification, suggesting that Ca2+ uptake precedes acidification (Fig. 3, F and G). Based on the effects of adding Ca2+ late in the reaction, we asked if adding EGTA would further enhance H+ uptake when added late. Unlike the effects of excess Ca2+, the addition of EGTA at 300 s did not affect acidification (Fig. 3H). We attribute this to the relative absence of extraluminal Ca2+ after 300 s of incubation as Ca2+ uptake is typically completed between 300 and 500 s (
      • Miner G.E.
      • Sullivan K.D.
      • Guo A.
      • Jones B.C.
      • Hurst L.R.
      • Ellis E.C.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates the transition between trans-SNARE complex formation and vacuole membrane fusion.
      ,
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ,
      • Miner G.E.
      • Starr M.L.
      • Hurst L.R.
      • Sparks R.P.
      • Padolina M.
      • Fratti R.A.
      The central polybasic region of the soluble SNARE (soluble N-Ethylmaleimide-sensitive factor Attachment protein receptor) Vam7 affects binding to phosphatidylinositol 3-phosphate by the PX (phox homology) domain.
      ,
      • Miner G.E.
      • Starr M.L.
      • Hurst L.R.
      • Fratti R.A.
      Deleting the DAG kinase Dgk1 augments yeast vacuole fusion through increased Ypt7 activity and altered membrane fluidity.
      ). Together, these data indicate that vacuole acidification was affected by changes in the vacuolar Ca2+ gradient. This was also consistent with the notion that Fab1 activity correlates with vesicle acidification through modulating extraluminal Ca2+ levels.

      Vacuole acidification in Fab1 mutants is inhibited by high levels of Ca2+

      In a previous study, we showed that Ca2+ uptake was prolonged in the presence of the fab1T2250A hyperactive mutant while Ca2+ uptake was attenuated when the fab1EEE inactive mutant was expressed (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). Based on this, we predicted that fab1T2250A vacuoles would be resistant to added Ca2+ relative to the WT and that fab1EEE vacuoles would be more sensitive. Instead, we found that WT, fab1T2250A, and fab1EEE vacuoles were equally sensitive to elevated Ca2+ at the micromolar levels needed to block vacuole acidification in vitro (Fig. 4). While this suggests that Fab1 activity does not affect acidification through Ca2+ flux, it is possible that the effects of high micromolar Ca2+ overwhelm the system causing it to act as if under shock conditions. If this is so, then the relationship between Ca2+, PI(3,5)P2, and vacuole acidification can be split into two major tracks. The first track occurs under homeostatic conditions where Ca2+ is at normal nontoxic levels. Here, Ca2+ uptake into the vacuole is primarily through the high affinity pump Pmc1 (
      • Cunningham K.W.
      • Fink G.R.
      Calcineurin-dependent growth control in Saccharomyces cerevisiae mutants lacking PMC1, a homolog of plasma membrane Ca2+ ATPases.
      ). Under these conditions, Pmc1 activity is linked to vacuole acidification and Fab1 activity. This notion is supported by the interactions between Pmc1 and Vph1 that is sensitive to C8-PI(3,5)P2, albeit at moderate levels (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). The second track is taken when Ca2+ is at toxic levels and the low affinity antiporter Vcx1 takes up Ca2+ while deacidifying the vacuole through H+ expulsion (
      • Miseta A.
      • Kellermayer R.
      • Aiello D.P.
      • Fu L.
      • Bedwell D.M.
      The vacuolar Ca2+/H+ exchanger Vcx1p/Hum1p tightly controls cytosolic Ca2+ levels in S. cerevisiae.
      ). The second track would bypass the need for the interactions between Pmc1, Vph1, and PI(3,5)P2. Thus, it is important to directly compare how vacuole lacking Vcx1 or Pmc1 reacts to added Ca2+.
      Figure thumbnail gr4
      Figure 4Effect of Ca2+ on fab1 mutants. Vacuoles from WT (A), fab1EEE (B), and fab1T2250A (C) were incubated with buffer or increasing levels of Ca2+ for 600 s. Separate reactions were performed in the absence of ATP. FCCP was added to all reactions at 600 s to collapse the H+ gradient. AO quenching was normalized to the initial fluorescence for each reaction that was set to 1. D, quantitation of multiple experiments showed a significant effect of treating reactions with 125 μM Ca2+ [F(5,28) = 130.9; ∗∗∗∗p < 0.0001] (One way ANOVA for multiple comparisons). Error bars are mean ± SD. Tukey’s multiple comparison test was used for individual p values (n = 5). ∗∗p < 0.01, ∗∗∗∗p < 0.001, ns, not significant. AO, acridine orange; FCCP, carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone.

      High Ca2+ levels alter vacuole acidification through Vcx1

      To determine which vacuolar Ca2+ transporter was linked to the effects on acidification activity, we used a panel of deletion strains lacking the Ca2+ exporter channel Yvc1, the Ca2+-ATPase importer pump Pmc1, and the Ca2+/H+ exchanger Vcx1. Yeast vacuoles are thought to only take up Ca2+ through Pmc1 and Vcx1, therefore, the deletion of one can function as a reporter for the other. Previous work by Ungermann et al. indicated that the inhibition of vacuole fusion by millimolar Ca2+ occurred through Vcx1 (
      • Ungermann C.
      • Wickner W.
      • Xu Z.
      Vacuole acidification is required for trans-SNARE pairing, LMA1 release, and homotypic fusion.
      ). In the absence of Vcx1, they showed that vacuole fusion was resistant to Ca2+ and able to take up quinacrine. The quinacrine assays were endpoint experiments using a single concentration of Ca2+ at 1.5 mM. Thus, it is possible that using lower micromolar levels of Ca2+ in a real-time assay could detect changes that were previously missed.
      Here, WT and Ca2+ transporter mutant vacuoles were used in AO fluorescence assays in the presence of a CaCl2 concentration curve. We found that the shift in AO fluorescence was inhibited when WT vacuoles were incubated in the presence of ≥250 μM Ca2+ as seen previously, showing again that vacuole acidification was blocked (Fig. 5, A and E). Similarly, the shift in AO fluorescence using vacuoles from yvc1Δ and pmc1Δ cells was inhibited by ≥250 μM Ca2+ (Fig. 5, B, C and E). The results with yvc1Δ vacuoles were as predicted since the TRP channel is an exporter of luminal Ca2+. The sensitivity seen with pmc1Δ vacuoles suggests that Vcx1 mediated transport of Ca2+ is linked to vacuole deacidification. When vcx1Δ vacuoles were tested, it showed that they were indeed resistant to the Ca2+ all concentrations (Fig. 5, D and E). Together, these data suggest that the excess added Ca2+ is taken up through Vcx1, leading to the expulsion of H+ through its antiporter activity. This is also in agreement with previous studies.
      Figure thumbnail gr5
      Figure 5Effect of Ca2+ on vacuole acidification with Ca2+ transporter mutants. Vacuoles from WT (A), yvc1Δ (B), pmc1Δ (C), and vcx1Δ (D) yeast strains were incubated with buffer, bafilomycin A1, or a curve a CaCl2 for 600 s. A separate reaction was performed in the absence of ATP. After ∼600 s, 30 μM FCCP was added to collapse the H+ gradient. AO fluorescence was normalized to the initial values set to 1. E, average changes in fluorescence in the absence or presence of 125 μM CaCl2 [F(7,32) = 44.27; ∗∗∗∗p < 0.0001] (One way ANOVA for multiple comparisons). Error bars are mean ± SD. Tukey’s multiple comparison test was used for individual p values (n ≥ 4). ∗∗∗∗p < 0.001. AO, acridine orange; FCCP, carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone.
      We next examined whether the effects of Ca2+ on V-ATPase activity also occurred after vacuoles had acidified. We added Ca2+ after 400 s of incubation and continued measuring fluorescence for 200 additional seconds before the addition of FCCP. WT and pmc1Δ vacuoles showed that the late addition of Ca2+ resulted in a dose-dependent increase in AO fluorescence at 520 nm, illustrating that H+ was released (Fig. 6, A, B and D). This was comparable to what was seen with the late addition of bafilomycin. When vcx1Δ vacuoles were tested, we again saw a resistance toward the added Ca2+ (Fig. 6, C and D). This further indicates that vacuole deacidification in the presence of micromolar levels of Ca2+ was linked to Vcx1 antiporter activity that released H+ as the result of taking in Ca2+.
      Figure thumbnail gr6
      Figure 6Late addition of Ca2+ and vacuole acidification. Vacuoles from WT (A), pmc1Δ (B), and vcx1Δ (C) yeast strains were incubated with buffer for 400 s. A separate reaction was performed in the absence of ATP. At 400 s, individual reactions were supplemented with additional reaction buffer or CaCl2 at the indicated concentrations. After ∼600 s, 30 μM FCCP was added to collapse the H+ gradient. AO fluorescence was normalized to the initial values set to 1. D, quantitation of multiple experiments in panel (C) showed a significant effect of treating reactions with Ca2+ after 600 s [F(5,42) = 25.85; ∗∗∗∗p < 0.0001] (One way ANOVA for multiple comparisons). Error bars are mean ± SD. Tukey’s multiple comparison test was used for individual p values (n ≥ 4). ∗∗p < 0.01, ∗∗∗∗p < 0.001. AO, acridine orange; FCCP, carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone.

      Cadmium and zinc do not inhibit vacuole acidification

      Others have shown that the addition of Ca2+ to synaptic vesicles led to the release of H+ with varying degrees of intensity (
      • Ono Y.
      • Mori Y.
      • Egashira Y.
      • Sumiyama K.
      • Takamori S.
      Expression of plasma membrane calcium ATPases confers Ca2+/H+ exchange in rodent synaptic vesicles.
      ,
      • Gonçalves P.P.
      • Meireles S.M.
      • Neves P.
      • Vale M.G.
      Ionic selectivity of the Ca2+/H+ antiport in synaptic vesicles of sheep brain cortex.
      ,
      • Cordeiro J.M.
      • Boda B.
      • Gonçalves P.P.
      • Dunant Y.
      Synaptotagmin 1 is required for vesicular Ca2+/H+-antiport activity.
      ). Using synaptic vesicles investigators have also show that the addition of Zn2+ and Cd2+ triggered an equivalent or more potent release of H+ versus adding Ca2+ (
      • Gonçalves P.P.
      • Meireles S.M.
      • Neves P.
      • Vale M.G.
      Ionic selectivity of the Ca2+/H+ antiport in synaptic vesicles of sheep brain cortex.
      ,
      • Cordeiro J.M.
      • Boda B.
      • Gonçalves P.P.
      • Dunant Y.
      Synaptotagmin 1 is required for vesicular Ca2+/H+-antiport activity.
      ). In rat kidney vesicles from brush border membranes, the addition of Cd2+ inhibited V-ATPase activity (
      • Herak-Kramberger C.M.
      • Brown D.
      • Sabolić I.
      Cadmium inhibits vacuolar H(+)-ATPase and endocytosis in rat kidney cortex.
      ). Zn2+ has also been shown to both inhibit and enhance V-ATPase function in different plants (
      • Fukao Y.
      • Ferjani A.
      V-ATPase dysfunction under excess zinc inhibits Arabidopsis cell expansion.
      ,
      • Kabała K.
      • Janicka-Russak M.
      Differential regulation of vacuolar H+-ATPase and H+-PPase in Cucumis sativus roots by zinc and nickel.
      ,
      • Vera-Estrella R.
      • Gómez-Méndez M.F.
      • Amezcua-Romero J.C.
      • Barkla B.J.
      • Rosas-Santiago P.
      • Pantoja O.
      Cadmium and zinc activate adaptive mechanisms in Nicotiana tabacum similar to those observed in metal tolerant plants.
      ). Finally, Cagnac et al. showed that both Cd2+ and Zn2+ could affect yeast vacuole acidification in a manner linked to Ca2+/H+ antiporter activity (
      • Cagnac O.
      • Aranda-Sicilia M.N.
      • Leterrier M.
      • Rodriguez-Rosales M.-P.
      • Venema K.
      Vacuolar cation/H+ antiporters of Saccharomyces cerevisiae.
      ). Together, these reports indicated that divalent cations other than Ca2+ can affect V-ATPase activity, albeit in different systems and with varying results.
      We used WT or Ca2+ transport deletion strains to test the effects Cd2+ and Zn2+. Contrary to what others found, we saw that Cd2+ addition significantly enhanced acidification in WT vacuoles (Fig. 7, A and C). Similar effects were observed with pmc1Δ vacuoles (Fig. 7, D and F) and vcx1Δ vacuoles (Fig. 7, G and I). When Zn2+ was tested, we found that there was no significant effect on any of the vacuole types (Fig. 7, B, C, E, F, H and I). Together, these data indicate that Cd2+ and Zn2+ do not reproduce the effects seen by the addition of Ca2+. Because of the activating effect of Cd2+ on vacuole acidification, we next asked if it could reverse the effects of Ca2+. To do this, we added a fixed amount of Ca2+ (250 μM) along with a curve of Cd2+. This showed that Cd2+ was able to partially restore vacuole acidification in the presence of Ca2+ (Fig. 7, J and L). Interestingly, Zn2+ had a similar effect on restoring the effects of Ca2+ on acidification, even though it had no effect on its own (Fig. 7, K and L). While the mechanism is unknown, the effect of Cd2+ could be attributed to its role as a mimetic and directly competing with Ca2+ for binding sites while not having an inhibitory effect. This is especially important to consider since Cd2+ can affect calmodulin (CaM)-dependent kinase II (CaMK-II) function and alter cytoskeletal dynamics as well as apoptosis (
      • Choong G.
      • Liu Y.
      • Templeton D.M.
      Interplay of calcium and cadmium in mediating cadmium toxicity.
      ). Less is known about the competition of Zn2+ and Ca2+; however, Zn2+ has been shown to alter Ca2+ binding to Calbindin D28K (
      • Omar S.I.
      • Albensi B.C.
      • Gough K.M.
      Protein structural analysis of Calbindin D28k function and dysregulation: potential competition between Ca(2+) and Zn(2.).
      ). Based on what we know now, we speculate that Cd2+ and Zn2+ compete with, or alter, the binding of Ca2+ to its site of action during V-ATPase activity.
      Figure thumbnail gr7
      Figure 7Effect of Cd2+ and Zn2+ on vacuole acidification. Vacuoles from WT (AC), pmc1Δ (DF), and vcx1Δ (GI) yeast strains were incubated with buffer, CdCl2, or ZnCl2 at the indicated concentrations. Reactions were incubated for 600 s, after which FCCP was added to collapse the H+ gradient. Average peak fluorescence quenching normalized to the initial fluorescence set to 1. The untreated control was normalized to 1 and relative increases or decreases were calculated for Cd2+ and Zn2+ treatments. JL, WT vacuoles were treated with a combination of 250 μM CaCl2 with concentration curves of Cd2+ (J) or Zn2+ (K). (L) average peak fluorescence quenching. Untreated control was set to 1 and relative changes in fluorescence were calculated for each treatment. Quantitation of multiple experiments showed a significant effect of treating reactions with Cd2+ and Zn2+. Data were analyzed using one-way ANOVA for multiple comparisons [F(2,9) = 16; ∗∗∗∗p = 0.0011] for (C), [F(2,9) = 13.99; ∗∗∗∗p = 0.0017] for (F), [F(2,9) = 33.79; ∗∗∗∗p < 0.0001] for (I), [F(3,8) = 34.94; ∗∗∗∗p < 0.0001] for (L). Error bars are mean ± SD. Tukey’s multiple comparison test was used for individual p values (n ≥ 3). ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗p < 0.0001. FCCP, carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone.

      Effects of altering V-ATPase function on Ca2+ transport

      Thus far, we have shown that modulating Ca2+ concentrations affected vacuole acidification. We next asked whether V-ATPase activity could in turn affect Ca2+ transport. The transport of Ca2+ in and out of the vacuole was detected by the Ca2+ binding fluorophore Cal-520 dextran conjugate, which fluoresces when bound to Ca2+ (
      • Miner G.E.
      • Sullivan K.D.
      • Guo A.
      • Jones B.C.
      • Hurst L.R.
      • Ellis E.C.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates the transition between trans-SNARE complex formation and vacuole membrane fusion.
      ,
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). Upon the addition of ATP, vacuoles transport Ca2+ from the medium into the vesicle lumen, which is seen by the loss in fluorescence. In contrast, the omission of ATP prevents Ca2+ from entering the vacuole, and fluorescence remains mostly unchanged through the duration of the experiment. Ca2+ is later released when SNAREs form complexes between vacuoles (
      • Merz A.J.
      • Wickner W.T.
      Trans-SNARE interactions elicit Ca2+ efflux from the yeast vacuole lumen.
      ). SNARE-dependent Ca2+ efflux is inhibited by various agents that block the fusion pathway prior trans-SNARE pairing including anti-Sec17 IgG, which stops the pathway at the priming stage (
      • Mayer A.
      • Wickner W.
      • Haas A.
      Sec18p (NSF)-driven release of Sec17p (alpha-SNAP) can precede docking and fusion of yeast vacuoles.
      ,
      • Haas A.
      • Wickner W.
      Homotypic vacuole fusion requires Sec17p (yeast alpha-SNAP) and Sec18p (yeast NSF).
      ). Our previous work showed that increasing levels of PI(3,5)P2 blocked Ca2+ efflux and fusion (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). Interestingly, PI(3,5)P2 does not affect trans-SNARE pairing, suggesting it has its effects between trans-SNARE pairing and Ca2+ efflux (
      • Miner G.E.
      • Sullivan K.D.
      • Guo A.
      • Jones B.C.
      • Hurst L.R.
      • Ellis E.C.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates the transition between trans-SNARE complex formation and vacuole membrane fusion.
      ).
      To start, we used WT vacuoles in the Cal-520 fluorescence assay to track the effects of vacuole acidification on Ca2+ transport. To do this, we treated vacuoles with chloroquine (CQ), which raises the pH of vacuoles (
      • Qiu Q.-S.
      • Fratti R.A.
      The Na+/H+ exchanger Nhx1p regulates the initiation of Saccharomyces cerevisiae vacuole fusion.
      ,
      • Busch G.L.
      • Wiesinger H.
      • Gulbins E.
      • Wagner H.J.
      • Hamprecht B.
      • Lang F.
      Effect of astroglial cell swelling on pH of acidic intracellular compartments.
      ). Untreated control vacuoles took up Ca2+ as seen by the loss of Cal-520 fluorescence (Fig. 8, A and B). This was followed by a rise in fluorescence near the 15 min mark as a reporter for SNARE-dependent efflux. The anti-Sec17 IgG-treated vacuoles took up Ca2+ but did not release it later due to the lack of SNARE pairing. We found that Ca2+ transport was delayed with 250 μM CQ and completely blocked with higher concentrations. This indicated that acidified vacuoles were needed for optimal Ca2+ uptake. To confirm that the levels of CQ used sufficiently blocked vacuole acidification, we used it in the AO acidification assay. As expected, we observed that CQ inhibited vacuole acidification in a dose-dependent manner (Fig. 8, C and D).
      Figure thumbnail gr8
      Figure 8Vacuole acidification affects Ca2+ transport. A, Ca2+ transport was measured using Cal-520 fluorescence assays using WT vacuoles in the presence or absence of ATP or ATP with a concentration curve of chloroquine. B, quantitation of multiple experiments in panel (A) showed a significant effect of treating reactions with chloroquine [F(8,18) = 18.61; ∗∗∗∗p < 0.0001] (One way ANOVA for multiple comparisons with no treatment as a control). Error bars are mean ± SD. Dunnett multiple comparison test was used for individual p values (n = 3). ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001. C, AO fluorescence using WT vacuoles in the presence of a concentration curve of chloroquine. FCCP was added after 600 s to collapse the H+ gradient. D, quantitation of multiple experiments in panel (C) showed a significant effect of treating reactions with chloroquine-treated reactions [F(4,20) = 131.8; ∗∗∗∗p < 0.0001] (One way ANOVA for multiple comparisons with no treatment as a control). Error bars are mean ± SD. Dunnett multiple comparison test was used for individual p values (n = 5). ∗∗∗∗p < 0.001. AO, acridine orange; FCCP, carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone.
      While CQ served as a tool for raising the overall pH of the vacuole lumen, it is not a specific inhibitor of V-ATPase activity. In fact, CQ has been used to lower the pH of hyperacidified vacuoles lacking the Na+K+/H+ antiporter Nhx1 (
      • Qiu Q.-S.
      • Fratti R.A.
      The Na+/H+ exchanger Nhx1p regulates the initiation of Saccharomyces cerevisiae vacuole fusion.
      ,
      • Brett C.L.
      • Tukaye D.N.
      • Mukherjee S.
      • Rao R.
      The yeast endosomal Na+K+/H+ exchanger Nhx1 regulates cellular pH to control vesicle trafficking.
      ). To test the effects of directly inhibiting V-ATPase activity, we used bafilomycin A1 in the Ca2+ flux assay. Adding bafilomycin at the beginning of the experiment completely blocked Ca2+ uptake by vacuoles, while the DMSO solvent had no effect, indicating that the effect was due to inhibiting V-ATPase activity (Fig. 9, A and B). Similarly, adding the V-ATPase inhibitor concanamycin A to reactions at the beginning completely blocked Ca2+ uptake (not shown). To see how quickly stopping V-ATPase function affected Ca2+ retention, we added bafilomycin after 10 min of incubation. This caused a rapid release of Ca2+ that reached the starting levels as measured by Cal-520 fluorescence. The Ca2+ release was faster and more pronounced than the natural SNARE-dependent release. Again, adding DMSO at the 10 min mark had no effect on Ca2+ flux, demonstrating that the release in Ca2+ was due to bafilomycin.
      Figure thumbnail gr9
      Figure 9V-ATPase inhibition affects Ca2+ transport. A, Cal-520 fluorescence was measured using WT vacuoles in the presence or absence of 100 nM bafilomycin A1, 140 μg/ml anti-Sec17, and DMSO. Bafilomycin was added at the beginning (T = 0) or after 10 min of incubation (T = 10). B, quantitation of fluorescence at 20 min of multiple experiments in panel (A) showed a significant effect of treating reactions with anti-Sec17, DMSO, and bafilomycin added at T = 0 min and T = 10 min [F(5,24) = 49.44; ∗∗∗∗p < 0.0001] (One way ANOVA for multiple comparisons). Error bars are mean ± SD. Tukey’s multiple comparison test was used for individual p values (n = 5). ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001. C, Cal-520 fluorescence was measured with WT vacuoles. Here, bafilomycin was added to reactions pretreated with anti-Sec17 to block SNARE activity. D, quantitation of fluorescence at 20 min of multiple experiments in panel (C) showed a significant effect of treating reactions with anti-Sec17, DMSO, and bafilomycin at T = 10 min to anti-Sec17 treated reactions [F(6,14) = 36.55; ∗∗∗∗p < 0.0001] (One way ANOVA for multiple comparisons). Error bars are mean ± SD. Tukey’s multiple comparison test was used for individual p values (n = 3). ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001. DMSO, dimethyl sulfoxide.
      Because the release of Ca2+ after the initial uptake has been linked to trans-SNARE pairing, we wanted to see if the effects of bafilomycin were also SNARE dependent. To this end, we added bafilomycin to reactions that were pretreated with anti-Sec17 IgG. We found that it led to the release of Ca2+ with the same kinetics and magnitude as adding bafilomycin alone, indicating that the release was independent of SNARE complex formation (Fig. 9, C and D). We should note that bafilomycin inhibits SNARE pairing on its own when added early in the pathway; however, the effects of adding it during docking/tether on already formed SNARE complexes is unknown (
      • Ungermann C.
      • Wickner W.
      • Xu Z.
      Vacuole acidification is required for trans-SNARE pairing, LMA1 release, and homotypic fusion.
      ). It is worth remembering that blocking SNARE function does not affect the acidification of vacuoles as measured by AO fluorescence (
      • Zhang C.
      • Balutowski A.
      • Feng Y.
      • Calderin J.D.
      • Fratti R.A.
      High throughput analysis of vacuolar acidification.
      ).
      Finally, we asked how mutations of the V-ATPase complex would affect Ca2+ transport. To do this, we tested the effect of deleting VPH1. First, we used vph1Δ vacuoles in the AO fluorescence assay to verify that the deletion indeed inhibited vacuole acidification. We observed that AO fluorescence at 520 nm was not affected when using vph1Δ vacuoles, indicating that V-ATPase was blocked as shown previously (
      • Zhang C.
      • Balutowski A.
      • Feng Y.
      • Calderin J.D.
      • Fratti R.A.
      High throughput analysis of vacuolar acidification.
      ) (Fig. 10, A and B). This also indicated that the Stv1 isoform of Vph1 does not replace Vph1 to form a functional V-ATPase. This is important to keep in mind because only the overexpression of Stv1 can partially restore vacuole quinacrine staining in cells lacking Vph1 (
      • Manolson M.F.
      • Wu B.
      • Proteau D.
      • Taillon B.E.
      • Roberts B.T.
      • Hoyt M.A.
      • et al.
      STV1 gene encodes functional homologue of 95-kDa yeast vacuolar H(+)-ATPase subunit Vph1p.
      ). To verify that Stv1 does not affect vacuole acidification, we used stv1Δ vacuoles in the AO fluorescence assay. As shown in Figure 10, C and D, stv1Δ vacuoles were able to become acidified, as well as the WT. The stv1Δ vacuoles were as sensitive to CQ as compared to WT (not shown). This further acknowledges the requirement for Vph1 in vacuole acidification.
      Figure thumbnail gr10
      Figure 10V-ATPase function affects Ca2+ transport. A, AO fluorescence using WT and vph1Δ vacuoles in the presence or absence of ATP. FCCP was added after 600 s to collapse the H+ gradient. B, average fluorescence at 400 s was compared between strains. Error bars are mean ± SD. (n = 9). Data were analyzed using Student’s unpaired two-tailed t test. ∗∗∗∗p < 0.0001 C, AO fluorescence using WT and stv1Δ vacuoles in the presence or absence of ATP. FCCP was added after 600 s to collapse the H+ gradient. D, average fluorescence at 400 s was compared between strains. Error bars are mean ± SD. (n = 6). E, Ca2+ transport assay using WT and stv1Δ vacuoles in the presence or absence of ATP or with both ATP and anti-Sec17 IgG to block SNARE-mediated Ca2+ efflux. F, quantitation of multiple experiments in panel (E) showed a significant effect of treating reactions chloroquine [F(3, 8) = 13.67; ∗∗p = 0.0016] (One way ANOVA for multiple comparisons with no treatment as a control). Error bars are mean ± SD. Dunnett multiple comparison test was used for individual p values (n = 3). ∗p < 0.05, ∗∗p < 0.01. G, Ca2+ transport assay using vph1Δ vacuoles in the presence or absence of ATP. H, Ca2+ transport assay using vph1E789Q vacuoles in the presence or absence of ATP. AO, acridine orange; FCCP, carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone.
      Next, we tested the effects of deleting VPH1 and STV1 on Ca2+ transport. We first tested stv1Δ vacuoles and found that they transported Ca2+ in a manner indistinguishable from WT vacuoles (Fig. 10, E and F). Moreover, they were equally sensitive to CQ treatment. When we tested vph1Δ vacuoles in Ca2+ transport assays, we found that they were able to take up Ca2+ but were inhibited in Ca2+ efflux (Fig. 10G). This showed that a functional V-ATPase was not needed for Pmc1 and Vcx1 activity. That said, the uptake was significantly slower versus the WT. Vacuoles lacking Vph1 did not plateau in Ca2+ uptake until ∼20 min of incubation compared with the 10 min uptake seen with WT. The uptake of Ca2+ by vph1Δ vacuoles appears at first to contradict the effects of bafilomycin; however, we must remain cognizant that physical interactions occur between Pmc1 and Vph1. We previously found that Pmc1 and Vph1 exist in a complex with the R-SNARE Nyv1 (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). Because Pmc1 activity is inhibited by its interaction with Nyv1 (
      • Takita Y.
      • Engstrom L.
      • Ungermann C.
      • Cunningham K.W.
      Inhibition of the Ca(2+)-ATPase Pmc1p by the v-SNARE protein Nyv1p.
      ) it is possible that Vph1 also inhibits Pmc1 through being part of the complex. This interaction would not be disrupted by bafilomycin as it binds the c-ring. Therefore, we propose that acidification is not required for Ca2+ uptake.
      The lack of an overall effect on Ca2+ uptake is also in disagreement with another study showing that the V1 subunit Vma2 was required for Ca2+ uptake in vivo (
      • Forster C.
      • Kane P.M.
      Cytosolic Ca2+ homeostasis is a constitutive function of the V-ATPase in Saccharomyces cerevisiae.
      ). We hypothesized that this was due to the loss of Vma2 ATPase activity and overall V-ATPase function, while Vph1 remained present to interact with Pmc1. It is also possible that the effects of deleting VMA2 eliminated interactions between V-ATPases and other proteins that could have direct or indirect effects on Ca2+ uptake. For instance, Vma2 interacts with actin, the formin Bni1, and the WASP homolog Las17 (
      • Isgandarova S.
      • Jones L.
      • Forsberg D.
      • Loncar A.
      • Dawson J.
      • Tedrick K.
      • et al.
      Stimulation of actin polymerization by vacuoles via Cdc42p-dependent signaling.
      ,
      • Miao Y.
      • Wong C.C.L.
      • Mennella V.
      • Michelot A.
      • Agard D.A.
      • Holt L.J.
      • et al.
      Cell-cycle regulation of formin-mediated actin cable assembly.
      ,
      • Michelot A.
      • Costanzo M.
      • Sarkeshik A.
      • Boone C.
      • Yates J.R.
      • Drubin D.G.
      Reconstitution and protein composition analysis of endocytic actin patches.
      ) and can stabilize filamentous actin in Arabidopsis (
      • Ma B.
      • Qian D.
      • Nan Q.
      • Tan C.
      • An L.
      • Xiang Y.
      Arabidopsis vacuolar H+-ATPase (V-ATPase) B subunits are involved in actin cytoskeleton remodeling via binding to, bundling, and stabilizing F-actin.
      ). The state of actin polymerization itself has been shown to affect plasma membrane localized Ca-ATPases (
      • Vanagas L.
      • de La Fuente M.C.
      • Dalghi M.
      • Ferreira-Gomes M.
      • Rossi R.C.
      • Strehler E.E.
      • et al.
      Differential effects of G- and F-actin on the plasma membrane calcium pump activity.
      ). While the links between Vma2, actin, and the vacuolar Ca-ATPase Pmc1 have not been well established, it is not unreasonable to think that different mutations in the V-ATPase could have distinct effects on Ca2+ uptake.
      Unlike Ca2+ uptake, Ca2+ efflux was completely abolished in vph1Δ vacuoles, showing that a functional V-ATPase was needed for Ca2+ efflux. This is consistent with another study showing that anti-Vph1 IgG both delayed Ca2+ uptake and blocked downstream efflux (
      • Bayer M.J.
      • Reese C.
      • Buhler S.
      • Peters C.
      • Mayer A.
      Vacuole membrane fusion: v0 functions after trans-SNARE pairing and is coupled to the Ca2+-releasing channel.
      ). We must also note that vph1Δ vacuoles consistently show a release of Ca2+ upon addition of ATP. The release lasts nearly 10 min before the vacuoles take up Ca2+. This accounts for the overall delay in Ca2+ uptake. The reason for this is unknown. We do know that Ca2+ is instantly released upon ATP addition when both Pmc1 and Vcx1 are deleted (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). This is attributed to a constant ATP-dependent release of Ca2+ that is masked or inhibited when both uptake mechanisms are in place; however, the source of the Ca2+ release remains unknown. We conclude that the V-ATPase has a dual function maintaining Ca2+ transport homeostasis. One function depends on the inhibition of Pmc1 by Vph1 and the second is the need for an H+ gradient for Ca2+ efflux.
      The lack of Vph1 is known to destabilize the V1–VO holocomplex, which raises the question of whether Ca2+ transport would be affected by a complete but attenuated V-ATPase. To test this, we used the vph1E789Q point mutant that allows for the assembly of the V-ATPase but inhibits its function in a vph1Δ stv1Δ double deletion (
      • Leng X.-H.
      • Manolson M.F.
      • Liu Q.
      • Forgac M.
      Site-directed mutagenesis of the 100-kDa subunit (Vph1p) of the yeast vacuolar (H+)-ATPase.
      ). We used vph1E789Q in the single vph1Δ deletion background since we already found that deleting STV1 had no effect on Ca2+ transport. We found that vph1E789Q vacuoles released Ca2+ at the start of the assay, as did the vph1Δ vacuoles (Fig. 10H). However, the duration of the release was short in comparison and total Ca2+ uptake was completed by the 10 min mark as seen with WT vacuoles. Also, similar to the Vph1 deletion, vph1E789Q vacuoles did not release Ca2+. These data suggest that the assembly of the V1–VO blocks the inhibitory effects of Vph1 on Pmc1, perhaps through inducing conformational changes.

      Discussion

      In this study, we present data showing that Ca2+ transport and vacuole acidification are interdependent and that they can be affected by PI(3,5)P2 under specific conditions. Elevating PI(3,5)P2 levels through the hyperactive fab1T2250A mutation increases vacuole acidification, whereas the kinase-dead fab1EEE mutant reduces acidification. Similarly, the presence or absence of PI(3,5)P2 has opposing effects on Ca2+ transport. In vitro Ca2+ transport assays show that Ca2+ is taken into the vacuole lumen upon the addition of ATP, after which a wave of Ca2+ is released from the organelle. While the uptake is independent of SNAREs, the release requires the formation of trans-SNARE complexes between paired vacuoles (
      • Merz A.J.
      • Wickner W.T.
      Trans-SNARE interactions elicit Ca2+ efflux from the yeast vacuole lumen.
      ). In a previous study, we found that either adding exogenous C8-PI(3,5)P2 or expressing fab1T2250A blocked the net Ca2+ released upon trans-SNARE complex formation between vesicles (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ). On the other hand, blocking Fab1 activity with apilimod arrested Ca2+ uptake and elicits the accelerated release of Ca2+. These findings led to the hypothesis that V-ATPase activity and Ca2+ transport are linked in part through the production of PI(3,5)P2.
      We further demonstrated the connection between H+ and Ca2+ transport by testing the effect of changing the concentration of free Ca2+ on the formation of an H+ gradient. First, we showed that increasing extraluminal Ca2+ blocked the shift in AO fluorescence, indicating that the H+ gradient had been broken. This was linked to the role of the Ca2+/H+ exchanger Vcx1. The converse was seen when extraluminal Ca2+ was chelated with EGTA. The lack of free Ca2+ augmented the rate of H+ uptake and formation of a proton gradient. Interestingly, the deletion of VCX1 does not replicate the accelerated H+ uptake seen with EGTA, suggesting that the difference was not due to the lack of H+ export by Vcx1. Thus, we can postulate that a separate Ca2+-dependent mechanism could modulate vacuole acidification.

      Ca2+ transporters interact with the V-ATPase

      Based on several reports looking at mammalian counterparts, physical interactions between V-ATPase subunits and various Ca2+ transporters are not rare. For instance, L-type Ca2+ channels in murine cells physically interact with the G2 subunit of the V-ATPase, and inhibition of V-ATPase function leads to the mislocalization of the Ca2+ channel (
      • Gao T.
      • Hosey M.M.
      Association of L-type calcium channels with a vacuolar H(+)-ATPase G2 subunit.
      ). Others have reported that the R-type Cav2.3 Ca2+ channel interacts with the G1-subunit of the V-ATPase and showed that bafilomycin A1 reduces Ca2+ transport (
      • Radhakrishnan K.
      • Kamp M.A.
      • Siapich S.A.
      • Hescheler J.
      • Lüke M.
      • Schneider T.
      Ca(v)2.3 Ca2+ channel interacts with the G1-subunit of V-ATPase.
      ). In yeast, the addition of an antibody against Vph1 blocks Ca2+ efflux (
      • Bayer M.J.
      • Reese C.
      • Buhler S.
      • Peters C.
      • Mayer A.
      Vacuole membrane fusion: v0 functions after trans-SNARE pairing and is coupled to the Ca2+-releasing channel.
      ). While not shown directly, it is possible that the antibody against Vph1 physically interfered with the interaction between the V-ATPase and the Ca-ATPase Pmc1. Previously, we found that Pmc1 physically interacts with a protein complex that includes Vph1 and the SNARE Nyv1 (
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ,
      • Takita Y.
      • Engstrom L.
      • Ungermann C.
      • Cunningham K.W.
      Inhibition of the Ca(2+)-ATPase Pmc1p by the v-SNARE protein Nyv1p.
      ). In this study, we found that deleting VPH1 does not inhibit Ca2+ uptake, while efflux was abolished. On the other hand, when V-ATPase activity was inhibited with bafilomycin A1, both uptake and efflux were inhibited. So, what is the difference? The difference is the presence or absence of Vph1. We know that Vph1 binds to Pmc1 and Nyv1, and we know that Nyv1 inhibits Pmc1 activity. Therefore, it stands to reason that Vph1 has an inhibitory effect on Pmc1. This is likely why we see Ca2+ uptake in vph1Δ vacuoles that are otherwise unacidified. Taken together, we think that acidification and physical inhibition by Vph1 can be separated as modes of regulating Ca2+ flux. It is also apparent that the physical interaction of transporters is likely a major component of their coregulation.
      The fact that the V-ATPase performs functions that are in addition to H+ translocation has been shown by many studies. For instance, in Drosophila neurons, the a1 subunit V100 (yeast Vph1) of the VO complex interacts with Ca2+-loaded CaM to promote normal eye development (
      • Zhang W.
      • Wang D.
      • Volk E.
      • Bellen H.J.
      • Hiesinger P.R.
      • Quiocho F.A.
      V-ATPase V0 sector subunit a1 in neurons is a target of calmodulin.
      ). In mammalian cells, the V-ATPase recruits the small GTPase Arf6 and its nucleotide exchange factor ARNO from the cytosol to endosomal membranes through interaction with the c-ring and a-2 subunits, respectively (
      • Hurtado-Lorenzo A.
      • Skinner M.
      • El Annan J.
      • Futai M.
      • Sun-Wada G.-H.
      • Bourgoin S.
      • et al.
      V-ATPase interacts with ARNO and Arf6 in early endosomes and regulates the protein degradative pathway.
      ). These interactions play a role in the endolysosomal degradative pathway. In neurons, the c-ring binds to the SNARE Synaptobrevin to reduce neurotransmitter release through SNARE-dependent fusion of synaptic vesicles and the plasma membrane (
      • Di Giovanni J.
      • Boudkkazi S.
      • Mochida S.
      • Bialowas A.
      • Samari N.
      • Lévêque C.
      • et al.
      V-ATPase membrane sector associates with synaptobrevin to modulate neurotransmitter release.
      ). Finally, in osteoclasts, the d2 subunit promotes osteoclast fusion independent of pH changes caused by V-ATPase (
      • Lee S.-H.
      • Rho J.
      • Jeong D.
      • Sul J.-Y.
      • Kim T.
      • Kim N.
      • et al.
      v-ATPase V0 subunit d2-deficient mice exhibit impaired osteoclast fusion and increased bone formation.
      ). Many more examples like these exist to illustrate that the V-ATPase can physically interact with other proteins to affect a variety of pathways.

      How does Ca2+-dependent signaling play a role in linking Ca2+ transport with vacuole acidification?

      Based on the literature, it is almost certain that Ca2+ is activating CaM signaling as part of vacuole acidification. First, CaM itself was shown to play a role in vacuole fusion (
      • Peters C.
      • Mayer A.
      Ca2+/calmodulin signals the completion of docking and triggers a late step of vacuole fusion.
      ). In that study, CaM was inhibited with antibodies or with specific inhibitors and found that the activity was mostly after the docking stage, which is ∼20 min into the pathway. On the other hand, vacuole acidification is complete after ∼6 min, suggesting that any effect that CaM has on acidification would likely be independent from what affects fusion. Our preliminary studies show that the CaM inhibitor W7 affects vacuole acidification by an unknown mechanism (our unpublished results). Second, the CaM-dependent protein phosphatase Calcineurin is known to inhibit Vcx1 even though its direct dephosphorylation has not been shown (
      • Cunningham K.W.
      • Fink G.R.
      Calcineurin inhibits VCX1-dependent H+/Ca2+ exchange and induces Ca2+ ATPases in Saccharomyces cerevisiae.
      ). Taken together, it is likely that CaM-dependent signaling is important in generating the vacuolar H+-gradient. Future studies will be needed to address this link.
      In conclusion, this study shows that vacuole acidification by the V-ATPase is regulated by Ca2+ homeostasis, which itself is affected by the V-ATPase. While the mechanism(s) for this relationship remains to be elucidated, we can add that their interdependence on the vacuole could be associated with the production of PI(3,5)P2. These connections begin to unveil a more complicated network of interactions that integrates the composition of the membrane with ion homeostasis.

      Experimental procedures

      Reagents

      Soluble reagents were dissolved in Pipes-Sorbitol buffer (20 mM Pipes–KOH, pH 6.8, 200 mM sorbitol) with 125 mM KCl, unless indicated otherwise. C8-PI(3,5)P2 (1,2-dioctanoyl-phosphatidylinositol 3,5-bisphosphate) was purchased from Echelon Inc. ATP was purchased from RPI. Apilimod, bafilomycin A1, concanamycin A, and verapamil were from Cayman Chemical and dissolved in DMSO. AO, Calcofluor White solution, chloroquine, CoA, creatine kinase, EGTA, FCCP, and quinacrine were purchased from Sigma. Creatine phosphate was from Abcam. Cal-520 dextran conjugate molecular weight 10,000 was from AAT Bioquest. FM4-64 was purchased from ThermoFisher. Anti-Sec17 IgG (
      • Mayer A.
      • Wickner W.
      • Haas A.
      Sec18p (NSF)-driven release of Sec17p (alpha-SNAP) can precede docking and fusion of yeast vacuoles.
      ), Pbi2 (Proteinase B inhibitor 2) (
      • Slusarewicz P.
      • Xu Z.
      • Seefeld K.
      • Haas A.
      • Wickner W.T.
      I2B is a small cytosolic protein that participates in vacuole fusion.
      ), GST-ML1N (
      • Dong X.
      • Shen D.
      • Wang X.
      • Dawson T.
      • Li X.
      • Zhang Q.
      • et al.
      PI(3,5)P(2) controls membrane trafficking by direct activation of mucolipin Ca(2+) release channels in the endolysosome.
      ), and GST-FYVE (
      • Gillooly D.J.
      • Morrow I.C.
      • Lindsay M.
      • Gould R.
      • Bryant N.J.
      • Gaullier J.M.
      • et al.
      Localization of phosphatidylinositol 3-phosphate in yeast and mammalian cells.
      ) were prepared as described and dialyzed against Pipes-Sorbitol buffer with 125 mM KCl.

      Strains and proton transport assay

      Vacuoles were isolated as described from BJ3505 genetic backgrounds and used for vacuole acidification and Ca2+ transport assays (Table 1) (
      • Miner G.E.
      • Sullivan K.D.
      • Guo A.
      • Jones B.C.
      • Hurst L.R.
      • Ellis E.C.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates the transition between trans-SNARE complex formation and vacuole membrane fusion.
      ,
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      ,
      • Zhang C.
      • Balutowski A.
      • Feng Y.
      • Calderin J.D.
      • Fratti R.A.
      High throughput analysis of vacuolar acidification.
      ,
      • Haas A.
      • Conradt B.
      • Wickner W.
      G-protein ligands inhibit in vitro reactions of vacuole inheritance.
      ,
      • Jones E.W.
      • Zubenko G.S.
      • Parker R.R.
      PEP4 gene function is required for expression of several vacuolar hydrolases in Saccharomyces cerevisiae.
      ). STV1 was deleted by homologous recombination using PCR products amplified from pAG32 plasmid with primers 5′-STV1-KO (5’ – AGGCCCACGAAGGTGATTGGAAGTTCAGTGTTGAATCT GTTTAGCTTGCCTCGTCC – 3′) and 3′-STV1-KO (5′- GCAAACGTAGCGCATGCAACATTGCGTGGATGGCGGCGTTAGTATCGA – 3′), with homology flanking the STV1 coding sequence. The PCR product was transformed into chemically competent yeast by standard lithium acetate methods and plated on yeast extract–peptone–dextrose (YPD) containing hygromycin (200 μg/ml) to generate BJ3505 stv1::hyhMX4 (RFY108). RFY107 (vph1Δ) was transformed with pRS316-VPH1E789Q (a gift from Dr P. Kane, Upstate Medical University, Syracuse, NY) to make RFY109. The proton pumping activity of isolated vacuoles was performed as described by others with some modifications (
      • Müller O.
      • Neumann H.
      • Bayer M.J.
      • Mayer A.
      Role of the Vtc proteins in V-ATPase stability and membrane trafficking.
      ,
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Hurst L.R.
      • Starr M.L.
      • Rivera-Kohr D.A.
      • et al.
      Copper blocks V-ATPase activity and SNARE complex formation to inhibit yeast vacuole fusion.
      ). In vitro acidification reactions (60 μl) contained 20 μg vacuoles, reaction buffer (20 mM Pipes-KOH pH 6.8, 200 mM sorbitol, 125 mM KCl, 5 mM MgCl2), ATP-regenerating system (1 mM ATP, 0.1 mg/ml creatine kinase, 29 mM creatine phosphate), 10 μM CoA, 283 nM Pbi2 (inhibitor of protease 2), and 15 μM of AO. Reaction mixtures were loaded into a black, half-volume 96-well flat-bottom plate with nonbinding surface. ATP-regenerating system or buffer was added, and reactions were incubated at 27 °C while AO fluorescence was monitored. Samples were analyzed in a fluorescence plate reader (POLARstar Omega, BMG Labtech) with the excitation filter at 485 nm and emission filter at 520 nm. Reactions were initiated with the addition of ATP-regenerating system following the initial measurement. After fluorescence quenching plateaus were reached, we added 30 μM FCCP to collapse the proton gradient and restore AO fluorescence.
      Table 1Yeast strains used in this study
      StrainGenotypeSource
      BJ3505MATa ura3–52 trp1-D101 his3-200 lys2–801 gal2 (gal3) can1 prb1-D1.6R pep4::HIS3(
      • Jones E.W.
      • Zubenko G.S.
      • Parker R.R.
      PEP4 gene function is required for expression of several vacuolar hydrolases in Saccharomyces cerevisiae.
      )
      RFY74BJ3505, yvc1::kanMX6(
      • Miner G.E.
      • Sullivan K.D.
      • Guo A.
      • Jones B.C.
      • Hurst L.R.
      • Ellis E.C.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates the transition between trans-SNARE complex formation and vacuole membrane fusion.
      )
      RFY76BJ3505, fab1::kanMX6(
      • Miner G.E.
      • Sullivan K.D.
      • Guo A.
      • Jones B.C.
      • Hurst L.R.
      • Ellis E.C.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates the transition between trans-SNARE complex formation and vacuole membrane fusion.
      )
      RFY78BJ3505, fab1::kanMX6, pRS416-FAB1T2250A(
      • Miner G.E.
      • Sullivan K.D.
      • Guo A.
      • Jones B.C.
      • Hurst L.R.
      • Ellis E.C.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates the transition between trans-SNARE complex formation and vacuole membrane fusion.
      )
      RFY80BJ3505, fab1::kanMX6, pRS416-FAB1EEE(
      • Miner G.E.
      • Sullivan K.D.
      • Guo A.
      • Jones B.C.
      • Hurst L.R.
      • Ellis E.C.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates the transition between trans-SNARE complex formation and vacuole membrane fusion.
      )
      RFY84BJ3505, pmc1::kanMX6(
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      )
      RFY86BJ3505, vcx1::kanMX6(
      • Miner G.E.
      • Sullivan K.D.
      • Zhang C.
      • Rivera-Kohr D.
      • Guo A.
      • Hurst L.R.
      • et al.
      Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
      )
      RFY107BJ3505, vph1::hphMX4(
      • Zhang C.
      • Balutowski A.
      • Feng Y.
      • Calderin J.D.
      • Fratti R.A.
      High throughput analysis of vacuolar acidification.
      )
      RFY108BJ3505, stv1::kanMX6This study
      RFY109BJ3505, vph1::hphMX4, pRS316-VPH1E789QThis study

      Calcium transport

      Vacuolar Ca2+ transport was measured as described (
      • Miner G.E.
      • Starr M.L.
      • Hurst L.R.
      • Sparks R.P.
      • Padolina M.
      • Fratti R.A.
      The central polybasic region of the soluble SNARE (soluble N-Ethylmaleimide-sensitive factor Attachment protein receptor) Vam7 affects binding to phosphatidylinositol 3-phosphate by the PX (phox homology) domain.
      ,
      • Miner G.E.
      • Fratti R.
      Real-time fluorescence detection of calcium efflux during vacuolar membrane fusion.
      ,
      • Sasser T.L.
      • Padolina M.
      • Fratti R.A.
      The yeast vacuolar ABC transporter Ybt1p regulates membrane fusion through Ca2+ transport modulation.
      ). In vitro Ca2+ transport reactions (60 μl) contained 20 μg vacuoles from BJ3505 backgrounds, reaction buffer, 10 μM CoA, 283 nM Pbi2, and 150 nM of the Ca2+ probe Cal-520 dextran conjugate molecular weight 10,000. Reaction mixtures were loaded into a black, half-volume 96-well flat-bottom plate with nonbinding surface. ATP-regenerating system was added, and reactions were incubated at 27 °C while Cal-520 fluorescence was monitored. Samples lacking ATP were used a negative control for Ca2+ uptake. Antibody against the SNARE cochaperone Sec17 was added as a negative control for SNARE-dependent Ca2+ efflux (
      • Merz A.J.
      • Wickner W.T.
      Trans-SNARE interactions elicit Ca2+ efflux from the yeast vacuole lumen.
      ). Samples were analyzed using a fluorescence plate reader with the excitation filter at 485 nm and emission filter at 520 nm. Reactions were initiated with the addition of ATP-regenerating system following the initial measurement. The effects of inhibitors on efflux were determined by the addition of buffer or inhibitors immediately following Ca2+ influx. Calibration was done using buffered Ca2+ standards (Invitrogen).

      Fluorescence microscopy

      In vivo vacuole staining with quinacrine and FM4-64 (5 μM) was carried out as described (
      • Miner G.E.
      • Fratti R.
      Real-time fluorescence detection of calcium efflux during vacuolar membrane fusion.
      ,
      • Vida T.A.
      • Emr S.D.
      A new vital stain for visualizing vacuolar membrane dynamics and endocytosis in yeast.
      ,
      • Weisman L.S.
      • Bacallao R.
      • Wickner W.
      Multiple methods of visualizing the yeast vacuole permit evaluation of its morphology and inheritance during the cell cycle.
      ). WT BJ3505 cells were grown overnight in YPD broth and diluted with fresh YPD to an A600 of ∼0.6 to 0.8. The new YPD was buffered to pH 7 with 50 mM Tris–HCl, pH 7.5. First, cells were treated with either buffer or CaCl2 and incubated for 15 min at 30 °C, after which cells were stained with 200 μM quinacrine and incubated for an additional 20 min at 30 °C. Cells were harvested by centrifugation, washed once with PBS, pH 7.2, and resuspended in 20 μl PBS. Cell walls were stained by adding 10 μl of Calcofluor White solution and incubating for 2 min. Cell samples were mixed with low-melting agarose and mounted onto glass slides and examined by fluorescence microscopy. Images were acquired using a Zeiss Axio Observer Z1 inverted microscope equipped with an X-Cite 120XL light source, Plan Apochromat 63X oil objective (NA 1.4), and an AxioCam CCD camera. Quinacrine was visualized using a 38 HE EGFP shift-free filter set, FM4-64 was visualized with a 42 HE CY 3 shift-free filter set, and Calcofluor White was visualized with a 49 4′,6-diamidino-2-phenylindole shift-free filter set.

      Data analysis and statistics

      Results are expressed as the mean ± SD. Experimental replicates (n) are defined as the number of separate experiments. Statistical analysis was performed by Student’s unpaired two-tailed t test or one-way ANOVA for multiple comparisons using Prism 9 (GraphPad). Statistical significance is represented as follows: ∗p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001.

      Data availability

      All primary data are available upon request. Additional data sharing information is not applicable to this study.

      Conflict of interest

      The authors declare that they have no conflicts of interest with the contents of this article.

      Author contributions

      C. Z., A. B., G. E. M., D. A. R-K., and R. A. F. conceptualization; C. Z., G. E. M., D. A. R-K., and R. A. F. formal analysis; R. A. F. resources; R. A. F., C. Z., A. B., Y. F., G. E. M., D. A. R-K., K. D. S., M. R. H., A. G., and J. D. C. investigation; C. Z., A. B., Y. F., G. E. M., D. A. R-K., K. D. S., M. R. H., A. G., and J. D. C. data curation; C. Z., G. E. M., and R. A. F. writing–original draft; C. Z., G. E. M., D. A. R-K., R. A. F., K. D. S., M. R. H., and J. D. C. and writing–review and editing; R. A. F. supervision; R. A. F. project administration; R. A. F. funding acquisition.

      Funding and additional information

      This research was supported by a grant from the National Institutes of Health ( R01-GM101132 ) and the National Science Foundation ( MCB 1818310 , MCB 2216742 ) to R. A. F. J. D. C. was partially supported by an NIGMS-NIH Chemistry-Biology Interface Training Grant ( 5T32-GM070421 ). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

      References

        • Südhof T.C.
        Calcium control of neurotransmitter release.
        Cold Spring Harb. Perspect. Biol. 2012; 4: a011353
        • Mindell J.A.
        Lysosomal acidification mechanisms.
        Annu. Rev. Physiol. 2012; 74: 69-86
        • Daverkausen-Fischer L.
        • Pröls F.
        Regulation of calcium homeostasis and flux between the endoplasmic reticulum and the cytosol.
        J. Biol. Chem. 2022; 298: 102061
        • Ariño J.
        • Ramos J.
        • Sychrova H.
        Monovalent cation transporters at the plasma membrane in yeasts.
        Yeast. 2019; 36: 177-193
        • Locke E.G.
        • Bonilla M.
        • Liang L.
        • Takita Y.
        • Cunningham K.W.
        A homolog of voltage-gated Ca(2+) channels stimulated by depletion of secretory Ca(2+) in yeast.
        Mol. Cell. Biol. 2000; 20: 6686-6694
        • Cunningham K.W.
        • Fink G.R.
        Calcineurin-dependent growth control in Saccharomyces cerevisiae mutants lacking PMC1, a homolog of plasma membrane Ca2+ ATPases.
        J. Cell Biol. 1994; 124: 351-363
        • Cunningham K.W.
        • Fink G.R.
        Calcineurin inhibits VCX1-dependent H+/Ca2+ exchange and induces Ca2+ ATPases in Saccharomyces cerevisiae.
        Mol. Cell. Biol. 1996; 16: 2226-2237
        • Miseta A.
        • Kellermayer R.
        • Aiello D.P.
        • Fu L.
        • Bedwell D.M.
        The vacuolar Ca2+/H+ exchanger Vcx1p/Hum1p tightly controls cytosolic Ca2+ levels in S. cerevisiae.
        FEBS Lett. 1999; 451: 132-136
        • Dunn T.
        • Gable K.
        • Beeler T.
        Regulation of cellular Ca2+ by yeast vacuoles.
        J. Biol. Chem. 1994; 269: 7273-7278
        • Halachmi D.
        • Eilam Y.
        Cytosolic and vacuolar Ca2+ concentrations in yeast cells measured with the Ca2+-sensitive fluorescence dye indo-1.
        FEBS Lett. 1989; 256: 55-61
        • Dong X.
        • Shen D.
        • Wang X.
        • Dawson T.
        • Li X.
        • Zhang Q.
        • et al.
        PI(3,5)P(2) controls membrane trafficking by direct activation of mucolipin Ca(2+) release channels in the endolysosome.
        Nat. Commun. 2010; 1: 38
        • Gary J.D.
        • Wurmser A.E.
        • Bonangelino C.J.
        • Weisman L.S.
        • Emr S.D.
        Fab1p is essential for PtdIns(3)P 5-kinase activity and the maintenance of vacuolar size and membrane homeostasis.
        J. Cell Biol. 1998; 143: 65-79
        • Bonangelino C.J.
        • Catlett N.L.
        • Weisman L.S.
        Vac7p, a novel vacuolar protein, is required for normal vacuole inheritance and morphology.
        Mol. Cell. Biol. 1997; 17: 6847-6858
        • Merz A.J.
        • Wickner W.T.
        Trans-SNARE interactions elicit Ca2+ efflux from the yeast vacuole lumen.
        J. Cell Biol. 2004; 164: 195-206
        • Miner G.E.
        • Sullivan K.D.
        • Guo A.
        • Jones B.C.
        • Hurst L.R.
        • Ellis E.C.
        • et al.
        Phosphatidylinositol 3,5-bisphosphate regulates the transition between trans-SNARE complex formation and vacuole membrane fusion.
        Mol. Biol. Cell. 2019; 30: 201-208
        • Miner G.E.
        • Sullivan K.D.
        • Zhang C.
        • Rivera-Kohr D.
        • Guo A.
        • Hurst L.R.
        • et al.
        Phosphatidylinositol 3,5-bisphosphate regulates Ca2+ transport during yeast vacuolar fusion through the Ca2+ ATPase Pmc1.
        Traffic. 2020; 21: 503-517
        • Banerjee S.
        • Clapp K.
        • Tarsio M.
        • Kane P.M.
        Interaction of the late endo-lysosomal lipid PI(3,5)P2 with the Vph1 isoform of yeast V-ATPase increases its activity and cellular stress tolerance.
        J. Biol. Chem. 2019; 294: 9161-9171
        • Li S.C.
        • Diakov T.T.
        • Xu T.
        • Tarsio M.
        • Zhu W.
        • Couoh-Cardel S.
        • et al.
        The signaling lipid PI(3,5)P₂ stabilizes V₁-V(o) sector interactions and activates the V-ATPase.
        Mol. Biol. Cell. 2014; 25: 1251-1262
        • Banerjee S.
        • Kane P.M.
        Direct interaction of the Golgi V-ATPase a-subunit isoform with PI(4)P drives localization of Golgi V-ATPases in yeast.
        Mol. Biol. Cell. 2017; 28: 2518-2530
        • Forster C.
        • Kane P.M.
        Cytosolic Ca2+ homeostasis is a constitutive function of the V-ATPase in Saccharomyces cerevisiae.
        J. Biol. Chem. 2000; 275: 38245-38253
        • Ohsumi Y.
        • Anraku Y.
        Calcium transport driven by a proton motive force in vacuolar membrane vesicles of Saccharomyces cerevisiae.
        J. Biol. Chem. 1983; 258: 5614-5617
        • Lang M.J.
        • Strunk B.S.
        • Azad N.
        • Petersen J.L.
        • Weisman L.S.
        An intramolecular interaction within the lipid kinase Fab1 regulates cellular phosphatidylinositol 3,5-bisphosphate lipid levels.
        Mol. Biol. Cell. 2017; 28: 858-864
        • Thomé M.P.
        • Filippi-Chiela E.C.
        • Villodre E.S.
        • Migliavaca C.B.
        • Onzi G.R.
        • Felipe K.B.
        • et al.
        Ratiometric analysis of Acridine Orange staining in the study of acidic organelles and autophagy.
        J. Cell Sci. 2016; 129: 4622-4632
        • Damas-Souza D.M.
        • Nunes R.
        • Carvalho H.F.
        An improved acridine orange staining of DNA/RNA.
        Acta Histochem. 2019; 121: 450-454
        • Nelson N.
        The vacuolar H(+)-ATPase--one of the most fundamental ion pumps in nature.
        J. Exp. Biol. 1992; 172: 19-27
        • Cai X.
        • Xu Y.
        • Cheung A.K.
        • Tomlinson R.C.
        • Alcázar-Román A.
        • Murphy L.
        • et al.
        PIKfyve, a class III PI kinase, is the target of the small molecular IL-12/IL-23 inhibitor apilimod and a player in Toll-like receptor signaling.
        Chem. Biol. 2013; 20: 912-921
        • Dayam R.M.
        • Saric A.
        • Shilliday R.E.
        • Botelho R.J.
        The phosphoinositide-gated lysosomal Ca(2+) channel, TRPML1, is required for phagosome maturation.
        Traffic. 2015; 16: 1010-1026
        • Duex J.E.
        • Tang F.
        • Weisman L.S.
        The Vac14p-Fig4p complex acts independently of Vac7p and couples PI3,5P2 synthesis and turnover.
        J. Cell Biol. 2006; 172: 693-704
        • Snider J.
        • Hanif A.
        • Lee M.E.
        • Jin K.
        • Yu A.R.
        • Graham C.
        • et al.
        Mapping the functional yeast ABC transporter interactome.
        Nat. Chem. Biol. 2013; 9: 565-572
        • Müller O.
        • Neumann H.
        • Bayer M.J.
        • Mayer A.
        Role of the Vtc proteins in V-ATPase stability and membrane trafficking.
        J. Cell Sci. 2003; 116: 1107-1115
        • Deprez M.-A.
        • Maertens J.M.
        • Olsson L.
        • Bettiga M.
        • Winderickx J.
        The role of Sch9 and the V-ATPase in the adaptation response to acetic acid and the consequences for growth and chronological lifespan.
        Microorganisms. 2021; 9: 1871
        • Deprez M.-A.
        • Eskes E.
        • Wilms T.
        • Ludovico P.
        • Winderickx J.
        pH homeostasis links the nutrient sensing PKA/TORC1/Sch9 ménage-à-trois to stress tolerance and longevity.
        Microb. Cell. 2018; 5: 119-136
        • Wilms T.
        • Swinnen E.
        • Eskes E.
        • Dolz-Edo L.
        • Uwineza A.
        • Van Essche R.
        • et al.
        The yeast protein kinase Sch9 adjusts V-ATPase assembly/disassembly to control pH homeostasis and longevity in response to glucose availability.
        PLoS Genet. 2017; 13: e1006835
        • Chen Z.
        • Malia P.C.
        • Hatakeyama R.
        • Nicastro R.
        • Hu Z.
        • Péli-Gulli M.-P.
        • et al.
        TORC1 determines Fab1 lipid kinase function at signaling endosomes and vacuoles.
        Curr. Biol. 2021; 31: 297-309.e8
        • Ho C.Y.
        • Choy C.H.
        • Wattson C.A.
        • Johnson D.E.
        • Botelho R.J.
        The Fab1/PIKfyve phosphoinositide phosphate kinase is not necessary to maintain the pH of lysosomes and of the yeast vacuole.
        J. Biol. Chem. 2015; 290: 9919-9928
        • Yamamoto A.
        • DeWald D.B.
        • Boronenkov I.V.
        • Anderson R.A.
        • Emr S.D.
        • Koshland D.
        Novel PI(4)P 5-kinase homologue, Fab1p, essential for normal vacuole function and morphology in yeast.
        Mol. Biol. Cell. 1995; 6: 525-539
        • Buckley C.M.
        • Heath V.L.
        • Guého A.
        • Bosmani C.
        • Knobloch P.
        • Sikakana P.
        • et al.
        PIKfyve/Fab1 is required for efficient V-ATPase and hydrolase delivery to phagosomes, phagosomal killing, and restriction of Legionella infection.
        PLoS Pathog. 2019; 15: e1007551
        • Gillooly D.J.
        • Morrow I.C.
        • Lindsay M.
        • Gould R.
        • Bryant N.J.
        • Gaullier J.M.
        • et al.
        Localization of phosphatidylinositol 3-phosphate in yeast and mammalian cells.
        EMBO J. 2000; 19: 4577-4588
        • Fratti R.A.
        • Jun Y.
        • Merz A.J.
        • Margolis N.
        • Wickner W.
        Interdependent assembly of specific regulatory lipids and membrane fusion proteins into the vertex ring domain of docked vacuoles.
        J. Cell Biol. 2004; 167: 1087-1098
        • Boeddinghaus C.
        • Merz A.J.
        • Laage R.
        • Ungermann C.
        A cycle of Vam7p release from and PtdIns 3-P-dependent rebinding to the yeast vacuole is required for homotypic vacuole fusion.
        J. Cell Biol. 2002; 157: 79-89
        • Zhang C.
        • Balutowski A.
        • Feng Y.
        • Calderin J.D.
        • Fratti R.A.
        High throughput analysis of vacuolar acidification.
        Anal. Biochem. 2022; 658: 114927
        • Weixel K.M.
        • Blumental-Perry A.
        • Watkins S.C.
        • Aridor M.
        • Weisz O.A.
        Distinct Golgi populations of phosphatidylinositol 4-phosphate regulated by phosphatidylinositol 4-kinases.
        J. Biol. Chem. 2005; 280: 10501-10508
        • Stroupe C.
        • Collins K.M.
        • Fratti R.A.
        • Wickner W.
        Purification of active HOPS complex reveals its affinities for phosphoinositides and the SNARE Vam7p.
        EMBO J. 2006; 25: 1579-1589
        • Karunakaran S.
        • Fratti R.A.
        The lipid composition and physical properties of the yeast vacuole affect the hemifusion-fusion transition.
        Traffic. 2013; 14: 650-662
        • Shmigol A.V.
        • Eisner D.A.
        • Wray S.
        The role of the sarcoplasmic reticulum as a Ca2+ sink in rat uterine smooth muscle cells.
        J. Physiol. 1999; 520: 153-163
        • Sorin A.
        • Rosas G.
        • Rao R.
        PMR1, a Ca2+-ATPase in yeast Golgi, has properties distinct from sarco/endoplasmic reticulum and plasma membrane calcium pumps.
        J. Biol. Chem. 1997; 272: 9895-9901
        • Lamers J.M.
        • Cysouw K.J.
        • Verdouw P.D.
        Slow calcium channel blockers and calmodulin. Effect of felodipine, nifedipine, prenylamine and bepridil on cardiac sarcolemmal calcium pumping ATPase.
        Biochem. Pharmacol. 1985; 34: 3837-3843
        • Terland O.
        • Grønberg M.
        • Flatmark T.
        The effect of calcium channel blockers on the H(+)-ATPase and bioenergetics of catecholamine storage vesicles.
        Eur. J. Pharmacol. 1991; 207: 37-41
        • Ungermann C.
        • Wickner W.
        • Xu Z.
        Vacuole acidification is required for trans-SNARE pairing, LMA1 release, and homotypic fusion.
        Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11194-11199
        • Flannery A.R.
        • Graham L.A.
        • Stevens T.H.
        Topological characterization of the c, c’, and c’’ subunits of the vacuolar ATPase from the yeast Saccharomyces cerevisiae.
        J. Biol. Chem. 2004; 279: 39856-39862
        • Miner G.E.
        • Sullivan K.D.
        • Zhang C.
        • Hurst L.R.
        • Starr M.L.
        • Rivera-Kohr D.A.
        • et al.
        Copper blocks V-ATPase activity and SNARE complex formation to inhibit yeast vacuole fusion.
        Traffic. 2019; 20: 841-850
        • Cagnac O.
        • Aranda-Sicilia M.N.
        • Leterrier M.
        • Rodriguez-Rosales M.-P.
        • Venema K.
        Vacuolar cation/H+ antiporters of Saccharomyces cerevisiae.
        J. Biol. Chem. 2010; 285: 33914-33922
        • Miner G.E.
        • Starr M.L.
        • Hurst L.R.
        • Sparks R.P.
        • Padolina M.
        • Fratti R.A.
        The central polybasic region of the soluble SNARE (soluble N-Ethylmaleimide-sensitive factor Attachment protein receptor) Vam7 affects binding to phosphatidylinositol 3-phosphate by the PX (phox homology) domain.
        J. Biol. Chem. 2016; 291: 17651-17663
        • Miner G.E.
        • Starr M.L.
        • Hurst L.R.
        • Fratti R.A.
        Deleting the DAG kinase Dgk1 augments yeast vacuole fusion through increased Ypt7 activity and altered membrane fluidity.
        Traffic. 2017; 18: 315-329
        • Ono Y.
        • Mori Y.
        • Egashira Y.
        • Sumiyama K.
        • Takamori S.
        Expression of plasma membrane calcium ATPases confers Ca2+/H+ exchange in rodent synaptic vesicles.
        Sci. Rep. 2019; 9: 4289
        • Gonçalves P.P.
        • Meireles S.M.
        • Neves P.
        • Vale M.G.
        Ionic selectivity of the Ca2+/H+ antiport in synaptic vesicles of sheep brain cortex.
        Brain Res. Mol. Brain Res. 1999; 67: 283-291
        • Cordeiro J.M.
        • Boda B.
        • Gonçalves P.P.
        • Dunant Y.
        Synaptotagmin 1 is required for vesicular Ca2+/H+-antiport activity.
        J. Neurochem. 2013; 126: 37-46
        • Herak-Kramberger C.M.
        • Brown D.
        • Sabolić I.
        Cadmium inhibits vacuolar H(+)-ATPase and endocytosis in rat kidney cortex.
        Kidney Int. 1998; 53: 1713-1726
        • Fukao Y.
        • Ferjani A.
        V-ATPase dysfunction under excess zinc inhibits Arabidopsis cell expansion.
        Plant Signal. Behav. 2011; 6: 1253-1255
        • Kabała K.
        • Janicka-Russak M.
        Differential regulation of vacuolar H+-ATPase and H+-PPase in Cucumis sativus roots by zinc and nickel.
        Plant Sci. 2011; 180: 531-539
        • Vera-Estrella R.
        • Gómez-Méndez M.F.
        • Amezcua-Romero J.C.
        • Barkla B.J.
        • Rosas-Santiago P.
        • Pantoja O.
        Cadmium and zinc activate adaptive mechanisms in Nicotiana tabacum similar to those observed in metal tolerant plants.
        Planta. 2017; 246: 433-451
        • Choong G.
        • Liu Y.
        • Templeton D.M.
        Interplay of calcium and cadmium in mediating cadmium toxicity.
        Chem. Biol. Interact. 2014; 211: 54-65
        • Omar S.I.
        • Albensi B.C.
        • Gough K.M.
        Protein structural analysis of Calbindin D28k function and dysregulation: potential competition between Ca(2+) and Zn(2.).
        Curr. Alzheimer Res. 2016; 13: 777-786
        • Mayer A.
        • Wickner W.
        • Haas A.
        Sec18p (NSF)-driven release of Sec17p (alpha-SNAP) can precede docking and fusion of yeast vacuoles.
        Cell. 1996; 85: 83-94
        • Haas A.
        • Wickner W.
        Homotypic vacuole fusion requires Sec17p (yeast alpha-SNAP) and Sec18p (yeast NSF).
        EMBO J. 1996; 15: 3296-3305
        • Qiu Q.-S.
        • Fratti R.A.
        The Na+/H+ exchanger Nhx1p regulates the initiation of Saccharomyces cerevisiae vacuole fusion.
        J. Cell Sci. 2010; 123: 3266-3275
        • Busch G.L.
        • Wiesinger H.
        • Gulbins E.
        • Wagner H.J.
        • Hamprecht B.
        • Lang F.
        Effect of astroglial cell swelling on pH of acidic intracellular compartments.
        Biochim. Biophys. Acta. 1996; 1285: 212-218
        • Brett C.L.
        • Tukaye D.N.
        • Mukherjee S.
        • Rao R.
        The yeast endosomal Na+K+/H+ exchanger Nhx1 regulates cellular pH to control vesicle trafficking.
        Mol. Biol. Cell. 2005; 16: 1396-1405
        • Manolson M.F.
        • Wu B.
        • Proteau D.
        • Taillon B.E.
        • Roberts B.T.
        • Hoyt M.A.
        • et al.
        STV1 gene encodes functional homologue of 95-kDa yeast vacuolar H(+)-ATPase subunit Vph1p.
        J. Biol. Chem. 1994; 269: 14064-14074
        • Takita Y.
        • Engstrom L.
        • Ungermann C.
        • Cunningham K.W.
        Inhibition of the Ca(2+)-ATPase Pmc1p by the v-SNARE protein Nyv1p.
        J. Biol. Chem. 2001; 276: 6200-6206
        • Isgandarova S.
        • Jones L.
        • Forsberg D.
        • Loncar A.
        • Dawson J.
        • Tedrick K.
        • et al.
        Stimulation of actin polymerization by vacuoles via Cdc42p-dependent signaling.
        J. Biol. Chem. 2007; 282: 30466-30475
        • Miao Y.
        • Wong C.C.L.
        • Mennella V.
        • Michelot A.
        • Agard D.A.
        • Holt L.J.
        • et al.
        Cell-cycle regulation of formin-mediated actin cable assembly.
        Proc. Natl. Acad. Sci. U. S. A. 2013; 110: E4446-E4455
        • Michelot A.
        • Costanzo M.
        • Sarkeshik A.
        • Boone C.
        • Yates J.R.
        • Drubin D.G.
        Reconstitution and protein composition analysis of endocytic actin patches.
        Curr. Biol. 2010; 20: 1890-1899
        • Ma B.
        • Qian D.
        • Nan Q.
        • Tan C.
        • An L.
        • Xiang Y.
        Arabidopsis vacuolar H+-ATPase (V-ATPase) B subunits are involved in actin cytoskeleton remodeling via binding to, bundling, and stabilizing F-actin.
        J. Biol. Chem. 2012; 287: 19008-19017
        • Vanagas L.
        • de La Fuente M.C.
        • Dalghi M.
        • Ferreira-Gomes M.
        • Rossi R.C.
        • Strehler E.E.
        • et al.
        Differential effects of G- and F-actin on the plasma membrane calcium pump activity.
        Cell Biochem. Biophys. 2013; 66: 187-198
        • Bayer M.J.
        • Reese C.
        • Buhler S.
        • Peters C.
        • Mayer A.
        Vacuole membrane fusion: v0 functions after trans-SNARE pairing and is coupled to the Ca2+-releasing channel.
        J. Cell Biol. 2003; 162: 211-222
        • Leng X.-H.
        • Manolson M.F.
        • Liu Q.
        • Forgac M.
        Site-directed mutagenesis of the 100-kDa subunit (Vph1p) of the yeast vacuolar (H+)-ATPase.
        J. Biol. Chem. 1996; 271: 22487-22493
        • Gao T.
        • Hosey M.M.
        Association of L-type calcium channels with a vacuolar H(+)-ATPase G2 subunit.
        Biochem. Biophys. Res. Commun. 2000; 277: 611-616
        • Radhakrishnan K.
        • Kamp M.A.
        • Siapich S.A.
        • Hescheler J.
        • Lüke M.
        • Schneider T.
        Ca(v)2.3 Ca2+ channel interacts with the G1-subunit of V-ATPase.
        Cell. Physiol. Biochem. 2011; 27: 421-432
        • Zhang W.
        • Wang D.
        • Volk E.
        • Bellen H.J.
        • Hiesinger P.R.
        • Quiocho F.A.
        V-ATPase V0 sector subunit a1 in neurons is a target of calmodulin.
        J. Biol. Chem. 2008; 283: 294-300
        • Hurtado-Lorenzo A.
        • Skinner M.
        • El Annan J.
        • Futai M.
        • Sun-Wada G.-H.
        • Bourgoin S.
        • et al.
        V-ATPase interacts with ARNO and Arf6 in early endosomes and regulates the protein degradative pathway.
        Nat. Cell Biol. 2006; 8: 124-136
        • Di Giovanni J.
        • Boudkkazi S.
        • Mochida S.
        • Bialowas A.
        • Samari N.
        • Lévêque C.
        • et al.
        V-ATPase membrane sector associates with synaptobrevin to modulate neurotransmitter release.
        Neuron. 2010; 67: 268-279
        • Lee S.-H.
        • Rho J.
        • Jeong D.
        • Sul J.-Y.
        • Kim T.
        • Kim N.
        • et al.
        v-ATPase V0 subunit d2-deficient mice exhibit impaired osteoclast fusion and increased bone formation.
        Nat. Med. 2006; 12: 1403-1409
        • Peters C.
        • Mayer A.
        Ca2+/calmodulin signals the completion of docking and triggers a late step of vacuole fusion.
        Nature. 1998; 396: 575-580
        • Slusarewicz P.
        • Xu Z.
        • Seefeld K.
        • Haas A.
        • Wickner W.T.
        I2B is a small cytosolic protein that participates in vacuole fusion.
        Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5582-5587
        • Haas A.
        • Conradt B.
        • Wickner W.
        G-protein ligands inhibit in vitro reactions of vacuole inheritance.
        J. Cell Biol. 1994; 126: 87-97
        • Jones E.W.
        • Zubenko G.S.
        • Parker R.R.
        PEP4 gene function is required for expression of several vacuolar hydrolases in Saccharomyces cerevisiae.
        Genetics. 1982; 102: 665-677
        • Miner G.E.
        • Fratti R.
        Real-time fluorescence detection of calcium efflux during vacuolar membrane fusion.
        Methods Mol. Biol. 2019; 1860: 323-331
        • Sasser T.L.
        • Padolina M.
        • Fratti R.A.
        The yeast vacuolar ABC transporter Ybt1p regulates membrane fusion through Ca2+ transport modulation.
        Biochem. J. 2012; 448: 365-372
        • Vida T.A.
        • Emr S.D.
        A new vital stain for visualizing vacuolar membrane dynamics and endocytosis in yeast.
        J. Cell Biol. 1995; 128: 779-792
        • Weisman L.S.
        • Bacallao R.
        • Wickner W.
        Multiple methods of visualizing the yeast vacuole permit evaluation of its morphology and inheritance during the cell cycle.
        J. Cell Biol. 1987; 105: 1539-1547