Advertisement

Toll-like receptor 4 and lipopolysaccharide from commensal microbes regulate Tembusu virus infection

  • Zhen Wu
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Tao Hu
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Andres Merits
    Affiliations
    Institute of Technology, University of Tartu, Tartu, Estonia
    Search for articles by this author
  • Yu He
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Mingshu Wang
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Renyong Jia
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Dekang Zhu
    Affiliations
    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Mafeng Liu
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Xinxin Zhao
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Qiao Yang
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Ying Wu
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Shaqiu Zhang
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Juan Huang
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Sai Mao
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Xumin Ou
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Qun Gao
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Di Sun
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Yunya Liu
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Ling Zhang
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Yanling Yu
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Anchun Cheng
    Correspondence
    Correspondence: (A.C.); Tel.: +86-028-86291621
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
  • Shun Chen
    Correspondence
    Correspondence: (S.C.); Tel.: +86-028-86291621
    Affiliations
    Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, China

    Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Chengdu, Sichuan 611130, China
    Search for articles by this author
Open AccessPublished:November 12, 2022DOI:https://doi.org/10.1016/j.jbc.2022.102699

      Abstract

      Unlike most flaviviruses transmitted by arthropods, Tembusu virus (TMUV) is still active during winter and causes outbreaks in some areas, indicating vector-independent spread of the virus. Gastrointestinal transmission might be one of the possible routes of vector-free transmission, which also means that the virus has to interact with more intestinal bacteria. Here, we found evidence that TMUV indeed can transmit through the digestive tract. Interestingly, using an established TMUV disease model by oral gavage combined with an antibiotic treatment, we revealed that a decrease in intestinal bacteria significantly reduced local TMUV proliferation in the intestine, revealing that the bacterial microbiome is important in TMUV infection. We found that lipopolysaccharide (LPS) present in the outer membrane of Gram-negative bacteria enhanced TMUV proliferation by promoting its attachment. Toll-like receptor 4 (TLR4), a cell surface receptor, can transmit signal from LPS. We confirmed co-localization of TLR4 with TMUV envelope (E) protein as well as their interaction in infected cells. Coherently, TMUV infection of susceptible cells was inhibited by an anti-TLR4 antibody, purified soluble TLR4 protein, and knockdown of TLR4 expression. LPS-enhanced TMUV proliferation could also be blocked by a TLR4 inhibitor. Meanwhile, pre-treatment of duck primary cells with TMUV significantly impaired LPS-induced IL6 production. Collectively, our study provides first insights into vector-free transmission mechanisms of flaviviruses.

      Keywords

      Introduction

      Egg drop disease syndrome, which is caused by Tembusu virus (TMUV), has emerged as a major avian health problem in Asia during the last decade (
      • Zhang W.
      • Chen S.
      • Mahalingam S.
      • Wang M.
      • Cheng A.
      An updated review of avian-origin Tembusu virus: a newly emerging avian Flavivirus.
      ,
      • Ninvilai P.
      • Tunterak W.
      • Oraveerakul K.
      • Amonsin A.
      • Thontiravong A.
      Genetic characterization of duck Tembusu virus in Thailand, 2015-2017: Identification of a novel cluster.
      ). The clinical symptoms of the disease include weight loss and egg production decline. The later stage of the disease is characterized by neurological symptoms, paralysis, and unstable walking. In addition, some sick birds exhibit additional symptoms, such as increased body temperature and discharge of green stool (
      • Zhang W.
      • Chen S.
      • Mahalingam S.
      • Wang M.
      • Cheng A.
      An updated review of avian-origin Tembusu virus: a newly emerging avian Flavivirus.
      ). TMUV is a flavivirus that has not been reported to cause symptoms in humans; however, the virus and neutralizing antibodies of TMUV can be detected in the blood of works of duckfarms (
      • Tang Y.
      • Gao X.
      • Diao Y.
      • Feng Q.
      • Chen H.
      • Liu X.
      • Ge P.
      • Yu C.
      Tembusu virus in human, China.
      ). Serum neutralizing antibodies can also be detected in people with no connection to duck factories (
      • Pulmanausahakul R.
      • Ketsuwan K.
      • Jaimipuk T.
      • Smith D.R.
      • Auewarakul P.
      • Songserm T.
      Detection of antibodies to duck tembusu virus in human population with or without the history of contact with ducks.
      ) indicating that TMUV also represents the public health risk.
      Under natural conditions, pathogenic flaviviruses are mainly transmitted by arthropods, such as mosquitoes and ticks. However, animals are still infected with TMUV during the cold season i.e. the prevalence of TMUV does not correlate with seasonal temperature changes that is not consistent with prevalence of mosquito-transmitted flaviviruses (
      • Li X.
      • Shi Y.
      • Liu Q.
      • Wang Y.
      • Li G.
      • Teng Q.
      • Zhang Y.
      • Liu S.
      • Li Z.
      Airborne Transmission of a Novel Tembusu Virus in Ducks.
      ). Previous research has suggested vector-less transmission for Japanese encephalitis virus (JEV) and West Nile virus (WNV) (
      • Ricklin M.E.
      • Garcia-Nicolas O.
      • Brechbuhl D.
      • Python S.
      • Zumkehr B.
      • Nougairede A.
      • Charrel R.N.
      • Posthaus H.
      • Oevermann A.
      • Summerfield A.
      Vector-free transmission and persistence of Japanese encephalitis virus in pigs.
      ,
      • Banet-Noach C.
      • Simanov L.
      • Malkinson M.
      Direct (non-vector) transmission of West Nile virus in geese.
      ). Coherently, Li et al. found that both direct contact and aerosol transmission can mediate the spread of TMUV among ducks (
      • Li X.
      • Shi Y.
      • Liu Q.
      • Wang Y.
      • Li G.
      • Teng Q.
      • Zhang Y.
      • Liu S.
      • Li Z.
      Airborne Transmission of a Novel Tembusu Virus in Ducks.
      ). TMUV transmission through airborne route and direct contact implies that compared to mosquito transmission the virus and commensal microbes have more interplay in the respiratory and digestive tracts during infection. The interaction between intestinal commensal bacteria and enteric viruses has been extensively studied and shown to promote the proliferation of different enteroviruses (
      • Kane M.
      • Case L.K.
      • Kopaskie K.
      • Kozlova A.
      • MacDearmid C.
      • Chervonsky A.V.
      • Golovkina T.V.
      Successful transmission of a retrovirus depends on the commensal microbiota.
      ,
      • Aguilera E.R.
      • Nguyen Y.
      • Sasaki J.
      • Pfeiffer J.K.
      Bacterial Stabilization of a Panel of Picornaviruses.
      ). Virions are stabilized by presence of bacteria upon heat treatment (
      • Robinson C.M.
      • Jesudhasan P.R.
      • Pfeiffer J.K.
      Bacterial lipopolysaccharide binding enhances virion stability and promotes environmental fitness of an enteric virus.
      ). The interaction between mouse mammary tumour virus (MMTV) and microbiota induces an immune evasion pathway (
      • Kane M.
      • Case L.K.
      • Kopaskie K.
      • Kozlova A.
      • MacDearmid C.
      • Chervonsky A.V.
      • Golovkina T.V.
      Successful transmission of a retrovirus depends on the commensal microbiota.
      ). It has been also noticed that commensal microbiota regulate immunity in the respiratory mucosa after infection with influenza A virus (IAV) and that commensal microbiota-induced immunity can inhibit IAV replication (
      • Ichinohe T.
      • Pang I.K.
      • Kumamoto Y.
      • Peaper D.R.
      • Ho J.H.
      • Murray T.S.
      • Iwasaki A.
      Microbiota regulates immune defense against respiratory tract influenza A virus infection.
      ). The direct interaction between IAV and commensal microbiota products, such as lipopolysaccharides (LPS) has also been shown to alter the morphology of IAV virions (
      • Bandoro C.
      • Runstadler J.A.
      Bacterial Lipopolysaccharide Destabilizes Influenza Viruses.
      ).
      Toll-like receptors (TLRs) are innate immune receptors that are related to the Toll protein of Drosophila (
      • Medzhitov R.
      • Preston-Hurlburt P.
      • Janeway Jr., C.A.
      A human homologue of the Drosophila Toll protein signals activation of adaptive immunity.
      ). TLR4 was the first TLR found in humans and is expressed in almost all cell types (
      • Kawai T.
      • Akira S.
      The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors.
      ). Several viral proteins have previously been reported to activate the TLR4 receptor, including G protein G protein of vesicular stomatitis virus (VSV), F protein of respiratory syncytial viral (RSV), glycoprotein of Ebola virus (EBOV), and NS1 protein of dengue virus (DENV) (
      • Harrison S.C.
      Viral membrane fusion.
      ,
      • Chao C.-H.
      • Wu W.-C.
      • Lai Y.-C.
      • Tsai P.-J.
      • Perng G.-C.
      • Lin Y.-S.
      • Yeh T.-M.
      Dengue virus nonstructural protein 1 activates platelets via Toll-like receptor 4, leading to thrombocytopenia and hemorrhage.
      ). TLR4 and its ligand incorporated into the retroviral envelope augment virus transmission (
      • Wilks J.
      • Lien E.
      • Jacobson A.N.
      • Fischbach M.A.
      • Qureshi N.
      • Chervonsky A.V.
      • Golovkina T.V.
      Mammalian Lipopolysaccharide Receptors Incorporated into the Retroviral Envelope Augment Virus Transmission.
      ). However, the mechanism(s) by which TLR4 interacts and uses flavivirus components has never been reported.
      Here, we examined the mechanisms of LPS and TLR4-mediated increase of TMUV infectivity. For the first time it was shown that TLR4 plays an important role during attachment step of TMUV infection. LPS was also found to be involved in TLR4-mediated enhancement of TMUV infection and the knockdown of TLR4 expression was shown to result in reduced the ability of LPS to promote virus adsorption. We propose a model that can explain the complex and important role played by LPS and TLR4 in TMUV infection: 1. TMUV binds LPS receptors by competing with LPS, thereby inhibiting host inflammatory signal transduction; 2. LPS also promotes TLR4-mediated TMUV attachment. As a consequence, reduced LPS sources such as intestinal commensal bacteria decrease TMUV proliferation in vivo. Importantly, these findings about the novel role of LPS in TMUV infection may apply to flavivirus infection in general.

      Results

      Intestinal bacteria facilitate TMUV oral infection

      To explore additional routes of TMUV transmission, 2-day-old ducklings were orally gavaged with 1x106 TCID50 of TMUV. Infectious virus could be detected in the brain and kidney, and in traces amounts also in spleen at 24 h post-infection, (Fig. 1A) confirming that TMUV could be infected through the digestive tract. To investigate the potential effect of the intestinal microbiota on TMUV infection, we depleted microbes by treating 1-day-old specific pathogen free (SPF) ducklings with antibiotics (Abx). As a side effect, the effect of Abx on the intestinal flora could affect the growth of animals (
      • Karst S.M.
      The influence of commensal bacteria on infection with enteric viruses.
      ). To reduce the side effects of antibiotic treatment, we treated the ducks gradually increasing the concentration of the antibiotics. Using this protocol, antibiotics treatment did not affect the growth of the ducks. On the 20th day, it was confirmed that the antibiotic treatment significantly reduced the cultural intestinal bacteria (Fig. 1B). We also monitored the intestinal movement of the ducks. In Abx treated ducks, the dye transit was significantly delayed at the early stage (4 h post-treatment) but returned to the normal from 12 h post-treatment (Fig. 1C). The in vitro experiments were performed using duck primary cells showed that antibiotics did not affect virus replication (Fig. 1D). At the same time, Abx treatment reduced TMUV proliferation in infected ducks; in average nearly ten-fold reduction was observed in the duodenum and three-fold reduction in the ileum, cecum and rectum (Fig. 1E, F, G and H, table 1). This data allows to concluding that the depletion of microbiota affected TMUV proliferation upon oral administration.
      Figure thumbnail gr1
      Fig. 1Intestinal bacteria facilitate TMUV infection. A. 2-days old ducklings (n=5) were gavaged with 1×106 TCID50 of TMUV for 24 h. The brain, kidneys, spleen, and liver were collected for virus detection. Virus titres were determined in BHK-21 cells. B. The ducks were treated with PBS or Abx for 20 days (n=5) for each group. The faeces were plated and grown anaerobically and aerobically. Resulting colony-forming units (CFU) per gram of faeces are blotted for each group. C.Untreated or Abx-treated ducklings (n=5 for each group) were orally administered Evan’s blue dye, and faeces were collected at 4, 12, and 24 h post-treatment. Faeces were suspended in PBS, and the amount of dye excreted was determined. D. TMUV (5×105 TCID50) was incubated with Abx (0.5 mg/ml) for 1 h at 4 °C, after which it was used to infect duck primary cells. Supernatants were sampled at 4 h, 12 h, and 24 h p. i. and TMUV titres were analysed using limiting dilution method. E, F, G, H Groups of PBS–treated (red) and Abx-treated (black) ducks (n = 5 ducks) were orally infected with 1×106 TCID50 units TMUV. At 24 h, the virus genomes present in the duodenum (E), ileum (F), caecum (G), and rectum (H) were quantified by using an RT–qPCR assay. Horizontal dotted lines denote the limit of detection (L.O.D. of the assay). The data are the mean ± SD of three independent experiments. *p < 0.05; **p<0.001; ***p < 0.001; ns, not significant.
      Table 1RT-qPCR primers used in this study
      Gene namePrimer sequences (5′ to 3′)
      duck TLR4Forward: CCATGGTGCTTTCTCCTGTGT
      Reverse: CTGGGTGGTGTTTGGGACTT
      TMUV EForward: AATGGCTGTGGCTTGTTTGG
      Reverse: GGGCGTTATCACGAATCTA
      Duck IL-6Forward: CCAAGGTGACGGAGGAAGAC
      Reverse: GTGAGGAGGGATTTCTGGGTAG
      Duck IFNbetaForward: TCTACAGAGCCTTGCCTGCAT
      Reverse: TGTCGGTGTCCAAAAGGATGT
      Duck β-actinForward: GATCACAGCCCTGGCACC
      Reverse: CGGATTCATCATACTCCTGCTT

      LPS treatment affects TMUV in vitro infection.

      To explore the mechanism of TMUV infection through intestine, we focused on the LPS, which is the outer membrane major component of Gram-negative bacteria and is known to modulate flavivirus infection (
      • Langendries L.
      • Jacobs S.
      • Abdelnabi R.
      • Verwimp S.
      • Kaptein S.
      • Baatsen P.
      • Van Mellaert L.
      • Delang L.
      Perturbation of Alphavirus and Flavivirus Infectivity by Components of the Bacterial Cell Wall.
      ). It has been reported that dengue virus (DENV) infection was inhibited by pretreating monocytes/macrophages with LPS and that this treatment blocked DENV entry (
      • Chen Y.C.
      • Wang S.Y.
      • King C.C.
      Bacterial lipopolysaccharide inhibits dengue virus infection of primary human monocytes/macrophages by blockade of virus entry via a CD14-dependent mechanism.
      ). In contrast to this report, we observed that the pre-treatment of duck primary cells with LPS for 12 h significantly enhanced TMUV infection, resulting in an approximately 60% increase of infectious virus in the supernatant, 4.6-fold increase of TMUV RNA levels in infected cells, and concomitant nearly 9-fold increase of the NS3 protein levels (Fig. 2A, B, and C). The effects resulting from incubation of TMUV virions and LPS prior were similar, albeit less pronounced: this treatment resulted in a nearly 60% increase of infectious virus in the supernatant, 2.5-fold increase of intracellular TMUV RNA levels, and 2.5-fold increase of the NS3 protein levels (Fig. 2D, E, and F). In contrast, when the cells were first infected with TMUV and treated with LPS at 12 h post-infection (h p.i.), no significant change in TMUV proliferation, RNA or NS3 protein levels was observed (Fig. 2G, H and I).
      Figure thumbnail gr2
      Fig. 2LPS pretreatment enhances TMUV infection in cell culture. A, B, C The cultures of 1×106 duck primary cells were treated with LPS (20 μg; LPS+CELL/TMUV) or mock-treated (CELL/TMUV) for 12 h before infection with 1×105 TCID50 TMUV. After 24 h p.i. the cells and culture supernatants were collected and assayed for extracellular infectious virus production (A), intracellular RNA replication; average level of TMUV RNA in the mock-treated cells was taken as 100% (B), and NS3 protein expression (C). D, E, F 1×105TCID50 of TMUV was preincubated with 20 μg of LPS (TMUV-LPS) or MEM (TMUV-MEM) for 1 h at 4 °C and used to infect duck primary cells. 24 h p.i. the culture supernatants and cells were collected and assayed for extracellular infectious virus titres (D), intracellular viral RNA amount; average level of TMUV RNA in the cells infected with MEM-treated virus was taken as 100% (E), and NS3 protein expression (F). G, H, I. 1×106 duck primary cells were infected with 1×105 TCID50 TMUV for 12 h and then treated with 20 μg LPS (TMUV+LPS) or mock-treated (TMUV) for 12 h. After this cell culture supernatants and cells were collected and assayed for infectious virus titres (G), intracellular viral RNA amount; average level of TMUV RNA in the mock-treated cells was taken as 100% (H), and NS3 protein expression (I). The data are the mean ± SD of three experiments. *p < 0.05; **p < 0.01; ***p < 0.001; ****p <0.0001; ns, not significant.
      Next, advantage was taken from single-round infection virus particle (SRIP). These particles contain truncated TMUV genome (replicon) where region encoding for prM and E protein was replaced with that encoding Nanoluciferase (Nluc) marker (
      • He Y.
      • Liu P.
      • Wang T.
      • Wu Y.
      • Lin X.
      • Wang M.
      • Jia R.
      • Zhu D.
      • Liu M.
      • Zhao X.
      • Yang Q.
      • Wu Y.
      • Zhang S.
      • Liu Y.
      • Zhang L.
      • Yu Y.
      • Pan L.
      • Chen S.
      • Cheng A.
      Genetically stable reporter virus, subgenomic replicon and packaging system of duck Tembusu virus based on a reverse genetics system.
      ). In cells infected with SRIP the Nluc activity level corresponds to the attachment, entry and replication steps of TMUV life cycle. SRIP were obtained by co-transfection of BHK-21 cells with the packaging plasmid prME and replicon plasmid. LPS and SRIP were mixed, incubated and used to infect cells (Fig. 3A middle and Fig. 3B upper panels). Alternatively, SRIP were also added to the LPS-pretreated (Fig. 3A-lower and 3B-lower panels). Both treatments enhanced infection by SRIP up to 1.5 fold (Fig. 3B). First, we determine whether LPS promotes TMUV infection by increasing the attachment to the cells, LPS was incubated used to treat TMUV virions (4 °C for 1 h, Fig. 3C-upper) or duck primary cells (37 °C for 12 h, Fig. 3C-lower). The treated and untreated samples were used in infection experiment; after brief 1 h of incubation at 37 °C, the unbound TMUV was removed and copy numbers of TMUV genomes in cell-bound virions were quantified by RT–qPCR. The results showed that both pre-treatment of TMUV with LPS (Fig. 3C-upper) or pre-treatment of cells with LPS (Fig. 3C-lower) significantly enhanced virus attachment.
      Figure thumbnail gr3
      Figure 3LPS treatments increase TMUV infection in dose dependent manner. A Schematic representation of the procedure used to examine the effect of LPS on SRIP infection. Middle panel, SRIP and LPS preincubation was performed at 4 °C for 1 h allowing virus and LPS binding; lower panel, LPS and duck primary cell preincubation was performed at 4 °C for 1 h allowing LPS and cell binding. At 48 h after SRIP infection, the cells were lysed to detect luminescence. B. Nluc activity for probes treated with LPS relative to the MEM treated samples (average Nluc activity in these samples was taken as 100%). Upper panel – pre-treatments of SIRP with 10 μg or 100 μg LPS; lower panel - pre-treatment of cells with 2 μg or 4 μg of LPS. C. Upper panel: TMUV virions were incubated with 20 μg of LPS or with MEM at 4 °C for 1 h and then used for infection of not treated cells; Lower panel: duck primary cells were incubated with 20 μg of LPS or with MEM at 37 °C for 12 h and infected with TMUV. Incubation was performed for 1h at 37 °C after which the unbound TMUV was removed by five washes with PBS. TMUV RNA levels in obtained samples were determined using RT-qPCR and effect of LPS treatments were calculated relative to the MEM-treated samples. D TMUV virions were incubated with MEM or 20 μg of LPS at 4 °C for the indicated times; infectivity of obtained probes was determined using limiting dilution method. E. TMUV virions were incubated with MEM or 20 μg of LPS at 42 °C for the 2 h; infectivity of obtained probes was determined using limiting dilution method. F. TMUV virions were incubated with 20 μg LPS or MEM at 4 °C, 28 °C, 37 °C and 42 °C for 8 h and infectivity of obtained probes was determined using limiting dilution method. The data are the mean ± SD of three experiments. *p < 0.05; **p < 0.01; ***p < 0.001; ns, not significant.
      Interestingly, we found that LPS enhanced TMUV infection only if virions were incubated with LPS at 4 °C for less than 4 h (Fig. 3D). The enhancement was also observed following incubation with TMUV with LPS for 2 h at 42 °C (Fig. 3E). After this the enhancing effect was lost and the TMUV infectivity was inhibited when the incubation was performed for 8 h (Fig. 3D). Furthermore, we found that the magnitude of inhibition, resulting from incubation of TMUV with LPS for 8 h, increased in a temperature-dependent manner (Fig. 3F). Combined, these results indicate that the presence of LPS is an important determinant of TMUV infection. However, its effect depends on time of exposure of TMUV virions: relatively short incubation with LPS promotes TMUV infection while the prolonged incubation has an opposite effect.

      TLR4 is essential for TMUV infection

      TLR4 plays a key role in LPS-induced signal transduction (
      • Ryu J.-K.
      • Kim S.J.
      • Rah S.-H.
      • Kang J.I.
      • Jung H.E.
      • Lee D.
      • Lee H.K.
      • Lee J.-O.
      • Park B.S.
      • Yoon T.-Y.
      • Kim H.M.
      Reconstruction of LPS Transfer Cascade Reveals Structural Determinants within LBP, CD14, and TLR4-MD2 for Efficient LPS Recognition and Transfer.
      ). Studies have shown that deletions, mutations or polymorphisms of gene encoding TLR4 as well as the downregulation of TLR4 expression all lead to hyporesponsiveness to LPS stimulation (
      • Nomura F.
      • Akashi S.
      • Sakao Y.
      • Sato S.
      • Kawai T.
      • Matsumoto M.
      • Nakanishi K.
      • Kimoto M.
      • Miyake K.
      • Takeda K.
      • Akira S.
      Cutting edge: endotoxin tolerance in mouse peritoneal macrophages correlates with down-regulation of surface toll-like receptor 4 expression.
      ,
      • Lorenz E.
      • Mira J.P.
      • Frees K.L.
      • Schwartz D.A.
      Relevance of mutations in the TLR4 receptor in patients with gram-negative septic shock.
      ,
      • Zacharowski K.
      • Zacharowski P.A.
      • Koch A.
      • Baban A.
      • Tran N.
      • Berkels R.
      • Papewalis C.
      • Schulze-Osthoff K.
      • Knuefermann P.
      • Zähringer U.
      • Schumann R.R.
      • Rettori V.
      • McCann S.M.
      • Bornstein S.R.
      Toll-like receptor 4 plays a crucial role in the immune-adrenal response to systemic inflammatory response syndrome.
      ). As LPS was found to affect TMUV attachment, we speculated that TLR4 may also play a role in TMUV infection. As shown in Fig 4A, expression of duck TLR4 in BHK-21 cells was found to increase TMUV attachment. And expression of duck TLR4 in duck primary cells also increased TMUV attachment, but there is no significant difference (Fig. 4B). It might be the transfection efficiency in primary cells is too low, results in the low expression of TLR4 protein on the surface of the cells. To verify the specificity of shRNA on TLR4 expression, we specifically silenced TLR4 expression in the other cells not express duck TLR4 (BHK21 cells) by co-transfection TLR4 expression plasmids and shRNA, both designed shRNA decreased TLR4 expression significantly (Fig. 4C). Then, it was found that silencing of TLR4 expression (Fig. 4D) inhibited accumulation of viral RNA (Fig. 4E) and NS3 protein (Fig. 4F and 4G) in duck primary cells. In conclusion, the over-expression of TLR4 promoting attachment of TMUV in cells (Fig 4A and 4B). Its depletion was similarly unfavourable for TMUV replication (Fig. 4E). Flaviviruses are known to utilize the E protein to interact with cell surface proteins (
      • Dejarnac O.
      • Hafirassou M.L.
      • Chazal M.
      • Versapuech M.
      • Gaillard J.
      • Perera-Lecoin M.
      • Umana-Diaz C.
      • Bonnet-Madin L.
      • Carnec X.
      • Tinevez J.Y.
      • Delaugerre C.
      • Schwartz O.
      • Roingeard P.
      • Jouvenet N.
      • Berlioz-Torrent C.
      • Meertens L.
      • Amara A.
      TIM-1 Ubiquitination Mediates Dengue Virus Entry.
      ), and above data confirming existence of important roles of TLR4 in TMUV entry. Here, we also examined whether the TMUV E protein may interact with TLR4. When duck primary cells were infected with TMUV, the co-localization of the E protein and endogenous TLR4 on the cell surface could be detected by immunofluorescence assay (IFA) (Fig. 4H). The direct interaction of these proteins was confirmed using a co-immunoprecipitation (Co-IP) assay which revealed that endogenous TLR4 was co-precipitated by TMUV E-protein specific antibody (Fig. 4I). Experiments using transient expression were performed to verify the specificity of TLR4 and TMUV E protein binding. When duck primary cells were co-transfected with plasmids expressing tagged versions of TLR4 and TMUV E protein, co-localization of two recombinant proteins was observed using IFA (Fig. 4J). The Co-IP analysis showed that the tagged TMUV E protein bound TLR4 (Fig. 4K), confirming interaction between TLR4 and TMUV E-protein and also demonstrating that this interaction is not mediated by other TMUV protein(s). Taken together, the above presented results indicate that there is a direct interaction between TMUV and TLR4. This may indicate the positive roles TLR4 has in TMUV infection.
      Figure thumbnail gr4
      Fig. 4TMUV proliferation is affected by TLR4. A, B. 1×106 BHK-21 cells or duck primary cells were transfected with empty plasmid (Mock) or plasmid expressing TLR4-strep II (TLR4). 24 h p.t. the cells were incubated with 5×105 TCID50 TMUV for 2 h; the unbound TMUV was removed by washing with PBS 5 times. The amount of TMUV RNA in cells was determined by RT–qPCR. An average amount of RNA in Mock cells was taken as 100%. C. BHK21 cells were co-transfected with a 75 or 150 ng of plasmid expressing TLR4 expression plasmids and TLR4 specific shRNA (shTRL4-124 and shTLR4-257) or 150 ng of plasmid expressing control shRNA (shNegative). Levels of TLR4 proteins were quantified by WB. D, E, F, G. 1×106 duck primary cells were transfected with a 75 or 150 ng of plasmid expressing TLR4 specific shRNA (shTRL4-124 and shTLR4-257) or 150 ng of plasmid expressing control shRNA (shNegative). At 48 h p.t. the cells were infected with 5×105 TCID50 of TMUV. Levels of TLR4 mRNAs (D) and TMUV RNA genomes (E) were quantified by RT–qPCR at 48 h.p.i. Average RNA levels measured in shNegative control cells were taken as 100%. A western blot analysis was performed to measure the levels of TLR4 and TMUV NS3 proteins in (F). The band intensities were measured and a ratio of NS3 to actin band intensity is presented; an average ratio in the shNegative transfected cells was taken as 100%. (G) H. 1×106 duck primary cells were infected with 1×105 TCID50 TMUV. At 24 h p.i. cells were stained with anti-E and anti-TLR4 antibodies, nuclei were counterstained with DAPI. Cells were imaged using Nikon Eclipse 80i fluorescence microscope. I. Duck primary cells were infected with TMUV for 24 h, 36 h, 48 h, or 60 h, lysed in IP buffer and TLR4 and TMUV E were immunoprecipitated using E protein antibodies (marked as IP). Obtained samples were analysed by a western blot, precipitated proteins and these in the original lysate were revealed using mouse anti-E and mouse anti-TLR4 antibodies (marked as IB). J. Duck primary cells were cotransfected with plasmid expressing TLR4-strep II and plasmid expressing C-terminally EGFP-tagged TMUV E protein. Cells were fixed 24 h p.t., stained with anti-strep II-tagged antibodies and DAPI; EGFP tagged E protein was detected using EGFP fluorescence. Images were taken using Nikon Eclipse 80i microscope. K. Duck primary cells were cotransfected with plasmids expressing TLR4-strep II and C-terminally EGFP-tagged TMUV E protein. Cells were lysed at 24 h p.t. and immunoprecipitation was performed using GFP antibody (left) or Strep-Tactin Sepharose (right). Precipitated samples and original lysates were analysed using immunoblotting with the indicated antibodies. The data on panels A, B, D, E, F are the mean ± SD of three experiments. *p < 0.05; **p < 0.01; ***p < 0.001; ****p <0.0001; ns, not significant.

      TLR4 acts as a TMUV attachment factor.

      To further clarify the role of TLR4 in the TMUV infection, anti-TLR4 antibody and purified TLR4 protein were used to analyse. In the first experiment, duck primary cells were incubated with TMUV at 4 °C for 1 h, a condition which allows virus attachment but not cell entry, in the presence of an anti-TLR4 antibody; normal (unspecific) rabbit IgG (rIgG) was used as negative control. After 24 h of incubation at 37 °C, the titres of TMUV were determined by a serial dilution method (Fig. 5A), and the expression of NS3 in infected cells was analysed using western blot (Fig. 5B and 5C). It was observed that the treatment with TLR4 antibody reduced TMUV infection: 60% reduction in released infectious virus titre (Fig. 5A) and statistically significant nearly 70% reduction in the NS3 protein level (Fig. 5C) were observed. In contrast, when antibodies were added after attachment step, the TLR4 antibody failed to inhibit TMUV infection (Fig. 5D, E, F). These results imply that TLR4 is involved in the attachment step of TMUV virions. Second, we determined the inhibitory activity of the TLR4 antibody using TMUV SRIP infection model (Fig. 5G). The pre-treatment of SRIP (Fig. 5G middle and 5H upper panels) or duck primary cells (Fig. 5G and 5H lower panels) with an anti-TLR4 antibody for 1 h at 4 °C significantly inhibited SRIP infection; up to 95% reduction of infection was observed for both treatments.
      Figure thumbnail gr5
      Fig. 5TLR4 is vital for TMUV attachment and infection. A, B, C Duck primary cells were incubated with TMUV virions at 4 °C for 1 h in the absence (control) or presence of various concentrations of an anti-TLR4 antibody or normal rabbit IgG (rIgG). The unbound TMUV was removed, cells were washed with PBS and then incubated at 37 °C for 24 h. D, E, F TMUV virions were allowed to bind to duck primary cells at 4 °C for 1 h before the addition of the anti-TLR4 antibody or rIgG. Incubation was continued at 4 °C for 1 h after which the cells were washed with PBS. Cells were further incubated in cell culture medium containing an anti-TLR4 antibody or rIgG at 37 °C for 6 h after which cell culture medium was replaced with fresh medium without the antibody and incubation was continued for 18 h at 37 °C. (A, D) TMUV-titres in the supernatants detected by limiting dilution method; (B, E) expression of NS3 in the TMUV-infected cells were detected by a western blot analysis, “-“ designates presence of rIgG, and (C, F) quantification of NS3 expression relative to actin Average ratio at the presence of rIgG was taken as 100%. The mean values ± SD of data from three independent experiments are shown in panels A, C, D and F. G. Schematic representation of the procedure used to examine the effect of the anti-TLR4 antibody on infectivity of TMUV SRIP. Upper panel, the generation of SRIP; middle panel, SRIP were pre-incubated with anti-TLR4 antibody at 4 °C for 1 h; lower panel, duck primary cells were pre-incubated with anti-TLR4 antibody at 4 °C for 1 h. SRIP attachment assays were performed as described for . H. SRIP treated with antibodies were used to infect duck primary cells (upper panel) or duck primary cells pre-incubated with antibodies were infected with SRIP (lower panel). Infected cells were incubated for 48 h; after this the cells were lysed and NLuc activities measured. NLuc activities in cells infected with rIgG treated SRIP (upper panel) or in cells pre-treated with rIgG (lower panel) were taken as 100%. I. 3 μl of anti-TLR4 antibody or rIgG were incubated with 1×103 or 1×106 TCID50 TMUV at 4 °C for 1 h. The attachment assay was performed using treated samples and duck primary cells after which cells were washed with PBS. The copy numbers RNA genomes present in TMUV virions bound to cells were determined by RT–qPCR. TMUV RNA copy numbers detected for probes incubated with rIgG treated samples were taken as 100% for each of used viral doses. J 5 μl of purified recombinant TLR4 protein was analysed using SDS-PAGE, the gel was stained with silver. K. 2 μl or 8 μl of TLR4 protein (from the same stock analysed on J) was incubated with 5×105 TCID50 of TMUV at 4 °C for 1 h. Treated samples were used to infect duck primary cells for 1 h. The unbound TMUV virions were removed by washing with PBS, and the copy number of RNA genomes present in TMUV virons bound to cells were determined by RT–qPCR. RNA copy number in the control sample where TMUV virions were treated with PBS was taken as 100%. The data on panels A, C, D, F, H, I and K are the mean ± SD of at least three experiments. **p < 0.01; ****p <0.0001; ns, not significant.
      To further confirm that the TLR4 antibody impaired TMUV attachment, duck primary cells were incubated at 4 °C for 1 h with low- or high-dose TMUV virions that were pre-treated with the TLR4 antibody or negative control antibody (rIgG). Again, it was observed that treatments with the TLR4 antibody inhibited virus attachment; the effect was prominent and significant both at case of high- and low-dose of TMUV (Fig. 5I). Finally, to explore the possible interaction between TLR4 and TMUV, we expressed and affinity purified recombinant duck TLR4 protein (Fig. 5J). 2 μl or 8 μl of obtained TLR4 protein stock was used to incubate with TMUV particles at 4 °C for 1 h. Subsequent binding assay performed with duck primary cells, which revealed that treatment with recombinant TLR4 markedly blocked TMUV binding to duck primary cells; compared to PBS (used as negative control) treated samples, the attachment was reduced, depending on amount of used TLR4 protein, from 75% to 99% (Fig. 5K). Collectively, data from these experiments confirms that TLR4 functions as important factor for TMUV attachment to duck cells.

      TLR4 is essential for LPS-enhanced TMUV adsorption

      As both LPS and TLR4 were found to be involved in TMUV attachment (Fig. 2, 3, and 5). we hypothesized that LPS may enhance the interaction strength between TMUV E protein and TLR4. TLR4-mediated LPS recognition requires the participation of protein called MD2; coherently the MD2 gene-deficient mice are tolerant to LPS treatment (
      • Gangloff M.
      • Gay N.J.
      MD-2: the Toll 'gatekeeper' in endotoxin signalling.
      ). MD2 forms TLR4-MD2 heterodimers that are used as the LPS signal receptors on macrophages. This mode of action opened possibility to treat cells with TLR4 antagonists (LPS-RS), which can compete with LPS for MD2 binding and thus inhibit TLR4 signalling (
      • Aida Y.
      • Kusumoto K.
      • Nakatomi K.
      • Takada H.
      • Pabst M.J.
      • Maeda K.
      An analogue of lipid A and LPS from Rhodobacter sphaeroides inhibits neutrophil responses to LPS by blocking receptor recognition of LPS and by depleting LPS-binding protein in plasma.
      ,
      • Teghanemt A.
      • Zhang D.
      • Levis E.N.
      • Weiss J.P.
      • Gioannini T.L.
      Molecular basis of reduced potency of underacylated endotoxins.
      ). Here, we incubated TMUV with LPS prior and added it into duck primary cells either treated or not with TLR4 antagonist (LPS-RS). It was found that the treatment of cells with LPS-RS significantly reduced positive effect of LPS on TMUV infection; the observed inhibition was approximately 2-fold (Fig. 6A). This finding was further confirmed using TLR4 knockdown assays: suppression of TLR4 levels inhibited TMUV attachment and, importantly, all gain resulting from LPS treatment of TMUV virions was lost (Fig. 6B). These results clearly demonstrate that TLR4 is involved in LPS-enhanced TMUV adsorption to the duck cells.
      Figure thumbnail gr6
      Fig. 6TLR4 is required for LPS-enhanced TMUV attachment. A. 1×105 TCID50 TMUV virions were pre-incubated with 20 μg of LPS (LPS+TMUV) or MEM (MEM+TMUV) for 1 h at 4 °C and used for infection of duck primary cells at 4 °C for 1 h. In addition, part of duck primary cells were pre-treated with the 20 μg TLR4 inhibitor LPS-RS at 37 °C for 1 h and infected with LPS+TMUV (LPS+TMUV/CELL+LPS-RS) at 4 °C for 1 h. All infected cells were washed with PBS and then incubated at 37 °C. At 24 h p.i. supernatants were harvested and the amount of infectious virus was determined using limiting dilution assay. B. Duck primary cells grown in 12-well plates were transfected with 2 μg of shRNA expressing plasmid shTLR4-124 or shNegative. At 48 h p.t., TMUV pre-incubated with 20 μg LPS for 1 h at 4 °C (LPS+TMUV) or TMUV pre-incububated with MEM (MEM+TMUV) was added and cells were incubated for 1 h at 4 °C. The unbound TMUV virions were removed by washing with PBS, and the copy number of RNA genomes present in TMUV bound to cells were determined by RT–qPCR; RNA copy number in cells transfected with shNegative and infected with MEM+TMUV (untreated control) was taken as 100%. The data are the mean ± SD of three experiments. **p < 0.01; ****p <0.0001; ns, not significant.

      TMUV inhibits LPS-mediated IL6 induction

      To further analyse the functional implications of interaction between LPS, TLR4, and TMUV, duck primary cells were infected with TMUV for 4 h, 12 h, 24 h, or 36 h. And IL6 mRNA and viral genome RNA copy numbers were determined. It was found that at 4 h, 12 h and 24 h, IL6 mRNA levels in TMUV infected cells were very low (Fig. 7A), and comparable with these in mock-infected cells. In contrast, TMUV RNA copy number increased approximately 2500 times from 4 h to 24 h (Fig. 7B). The massive replication of TMUV did not cause the induction of IL6 mRNA expression. Thus, during active stages of TMUV RNA replication, the induction of IL6 mRNA expression was likely actively suppressed by the virus. The expression of IL6 can be induced by various stimuli, including LPS treatment (
      • Hirschfeld M.
      • Ma Y.
      • Weis J.H.
      • Vogel S.N.
      • Weis J.J.
      Cutting edge: repurification of lipopolysaccharide eliminates signaling through both human and murine toll-like receptor 2.
      ). Indeed, we observed that LPS treatment of cells for 9 h increased IL6 mRNA levels nearly 400 times; interestingly, this effect was completely lost when cells were infected with TMUV prior (Fig. 7C). The results indicate that TMUV infection suppress the ability of LPS to induce IL6 production. Finally, we also investigated whether TMUV infection inhibits the LPS-mediated induction of IL6 expression in a time-dependent manner (Fig. 7D). The results revealed that at the early stage of infection, TMUV inhibited LPS-induced IL6 production; the inhibition was roughly at similar level for 2 h, 4 h and 12 h p.i., but was lost at 24 h p.i. (Fig. 7D). These results clearly show that at early stages of infection TMUV can suppress IL6 expression. The mechanism of this suppression remains to be revealed although it can be speculated that TMUV and/or TMUV E-protein might occupy the binding sites of LPS on the cell surface which temporarily (during stages of rapid virus genome replication) leads to inhibition of TLR4 mediated signal transduction.
      Figure thumbnail gr7
      Fig. 7TMUV infection impairs LPS-induced IL6 production. A, B 1×106 duck primary cells were grown in a 12-well plate and infected with 1×105TCID5 TMUV for 4 h, 12 h, 24 h, and 36 h. At these time points cells were collected, total RNA was isolated, and the expression of IL6 mRNA (A) and intracellular copy number of TMUV RNA genome (B) were analysed by RT–qPCR. Culture supernatants were also collected and assayed for extracellular infectious virus production using limiting dilution assay (B). C. Duck primary cells were infected with 5×105 TCID50 of TMUV, and treated with LPS (TMUV+LPS) or not treated (TMUV+MEM). In addition, control cells were mock infected and treated with LPS (Mock+LPS). Infected and/or LPS treated cells were incubated 9 h at 37 °C. D. Duck primary cells were mock-infected or infected with 5×105 TCID50 of TMUV for 2 h, 4 h, 12 h, and 24 h. Then, the cells were stimulated with 20 μg LPS for 3 h. (C, D) After indicated incubation times cell were collected, total RNA isolated and the levels of IL6 mRNA were measured by specific RT–qPCR. The data are the mean ± SD of three experiments. For A, C and D the IL6 mRNA levels in infected and/or LPS treated cells are shown relative to the mock-infected non-treated cells (IL6 mRNA levels in these cells were taken as 1). **p < 0.01; ***p < 0.001; ns, not significant.

      Discussion

      DENV infection of bone marrow-derived macrophages results in rapid induction of the transcription of inflammation-related factors (
      • Chao C.-H.
      • Wu W.-C.
      • Lai Y.-C.
      • Tsai P.-J.
      • Perng G.-C.
      • Lin Y.-S.
      • Yeh T.-M.
      Dengue virus nonstructural protein 1 activates platelets via Toll-like receptor 4, leading to thrombocytopenia and hemorrhage.
      ,
      • Chen J.
      • Ng M.M.
      • Chu J.J.
      Activation of TLR2 and TLR6 by Dengue NS1 Protein and Its Implications in the Immunopathogenesis of Dengue Virus Infection.
      ). In contrast, we found that at the early stage TMUV infection of duck primary cells did not induce IL6 production which become activated only at 24 h p.i, (Fig. 4C) or even later (Fig. 7A). Furthermore, cells infected with TMUV for 2-12 h were resistant to the stimulate of LPS, a strong inducer of IL6 expression, adding of which could not induce the high level production of IL6 (Fig. 7D). Based on this data it was assumed that the virus interacted with IL6-related receptors, leading to active inhibition of the production of inflammatory factors at the early stage of infection. Because LPS cannot directly enter the cell, the cell surface receptor such as TLR4 is needed to transduce the LPS signal (
      • Netea M.G.
      • van der Graaf C.
      • Van der Meer J.W.M.
      • Kullberg B.J.
      Toll-like receptors and the host defense against microbial pathogens: bringing specificity to the innate-immune system.
      ). Therefore, we speculate that LPS competes with TMUV virions or TMUV encoded protein(s) for binding to the same cell receptor. This assumption is supported by findings from co-localization and co-IP experiments which showed that TLR4 could interact with the E protein of TMUV (Fig. 4I-4L). TLR4 plays a complex role in the viral life cycle through different mechanisms. The G protein of VSV, F protein of RSV, and glycoproteins of EBOV (
      • Lai C.-Y.
      • Strange D.P.
      • Wong T.A.S.
      • Lehrer A.T.
      • Verma S.
      Ebola Virus Glycoprotein Induces an Innate Immune Response via TLR4.
      ) can interact with TLR4 when these viruses infect cells resulting in activation of TLR4 signalling, and induction of the production of downstream inflammatory factors. The knockdown of TLR4 expression in Kaposi sarcoma herpesvirus (KSHV) infected cells decreased the expression of inflammatory factors and IFN genes and resulted in a higher viral gene expression (
      • Lagos D.
      • Vart R.J.
      • Gratrix F.
      • Westrop S.J.
      • Emuss V.
      • Wong P.P.
      • Robey R.
      • Imami N.
      • Bower M.
      • Gotch F.
      • Boshoff C.
      Toll-like receptor 4 mediates innate immunity to Kaposi sarcoma herpesvirus.
      ). Even more complicated, viruses from different families infect TLR4 knockout mice, resulting in a mortality rate similar to that of the control group (
      • Younan P.
      • Ramanathan P.
      • Graber J.
      • Gusovsky F.
      • Bukreyev A.
      The Toll-Like Receptor 4 Antagonist Eritoran Protects Mice from Lethal Filovirus Challenge.
      ,
      • Modhiran N.
      • Watterson D.
      • Blumenthal A.
      • Baxter A.G.
      • Young P.R.
      • Stacey K.J.
      Dengue virus NS1 protein activates immune cells via TLR4 but not TLR2 or TLR6.
      ,
      • Glasner D.R.
      • Ratnasiri K.
      • Puerta-Guardo H.
      • Espinosa D.A.
      • Beatty P.R.
      • Harris E.
      Dengue virus NS1 cytokine-independent vascular leak is dependent on endothelial glycocalyx components.
      ,
      • Marr N.
      • Turvey S.E.
      Role of human TLR4 in respiratory syncytial virus-induced NF-kappaB activation, viral entry and replication.
      ).
      Interestingly, we observed a massive increase in IL6 expression in TMUV infected duck primary cells at 36 h.p.i. (Fig. 7A). This phenomenon suggests an existence of competition between TMUV infection and activation of innate immune response. Cells employ pattern recognition receptors to sense viruses, and viruses use multiple strategies to escape cell sensing. Some factors involved in the flavivirus life cycle, such as NS1, have been shown to induce the production of IL6 (
      • Modhiran N.
      • Watterson D.
      • Blumenthal A.
      • Baxter A.G.
      • Young P.R.
      • Stacey K.J.
      Dengue virus NS1 protein activates immune cells via TLR4 but not TLR2 or TLR6.
      ). Our results suggest that the E protein of TMUV plays an important and opposite role by acting as inhibitor of IL6 production. This E protein could counteract induction of cytokine production induced by other factors, such as NS1, and facilitating virus proliferation at early stages of infection. It is plausible that at the late stage of the infection, E protein cannot maintain this function, possibly because the high levels of NS1 expression and secretion. Therefore, the massive increase in IL6 expression occurs at 36 h p.i. (Fig. 7A); an ability of TMUV infection to counteract IL6 induction by external inducers (such as LPS) is also lost at later time points (Fig. 7D). On mechanistic side, it is also possible that earlier in the infection, the amount of TMUV is too low to activate the TLR4 signalling pathway. Higher TMUV load may lead to a higher expression of other viral proteins, such as NS1, which can induce the production of IL6. There is also likely a synergistic action between these TMUV encoded components and potent IL6 inducer such as LPS; presence of both enables cells to reach the tipping point faster (compare Fig. 7A and 7D). It’s interesting. However, that induction of IL6 production occurs at the time when virus RNA copies have already reached high levels (Fig. 7B). This is unlikely coincidental and most likely indicates that at this stage of infection, IL6 production causes little to no harm for virus and therefore suppression of IL6 production becomes not essential.
      Because TMUV can also inhibit LPS-induced IL6 production and LPS is an agonist of TLR4, we further explored the interaction between LPS and TMUV. Previous data suggest that poliovirus infections are enhanced by LPS, which enhances stability of poliovirus virions and increases their bleach resistance (
      • Robinson C.M.
      • Jesudhasan P.R.
      • Pfeiffer J.K.
      Bacterial lipopolysaccharide binding enhances virion stability and promotes environmental fitness of an enteric virus.
      ,
      • Kuss S.K.
      • Best G.T.
      • Etheredge C.A.
      • Pruijssers A.J.
      • Frierson J.M.
      • Hooper L.V.
      • Dermody T.S.
      • Pfeiffer J.K.
      Intestinal microbiota promote enteric virus replication and systemic pathogenesis.
      ). Here, we observed that pre-treatment of duck primary cells with LPS also did enhance TMUV infection and that pre-treatment of TMUV virions with LPS resulted in similar effect (Fig. 2, 3). Unlike to the mechanism promoting enterovirus infection, we found that LPS promotes virus TMUV infection by increasing its attachment to the cells and that this effect is lost when time of treatment of TMUV virions with LPS is prolonged (Fig. 3D, Fig. 8).
      Figure thumbnail gr8
      Fig. 8Proposed model of TMUV entry into duck primary cells. A. TLR4 is involved in the attachment steps of TMUV infection cycle and can function in the absence of LPS. However, the presence of LPS can significantly enhances the ability of TMUV virions for attachment to duck primary cells. Enhancing occurs as results of short-term incubation of TMUV virions with LPS and can be affected by factors shown on B. Long-term incubation of TMUV virions with LPS reduces the stability of the virions and their ability to infect duck primary cells is diminished.
      Attachment of virions to host cells is complex process and many molecules of the host cell are involved in the entry of viruses into cells. The virion envelope can also be embedded with host molecules that participate in the virus life cycle (
      • Wilks J.
      • Lien E.
      • Jacobson A.N.
      • Fischbach M.A.
      • Qureshi N.
      • Chervonsky A.V.
      • Golovkina T.V.
      Mammalian Lipopolysaccharide Receptors Incorporated into the Retroviral Envelope Augment Virus Transmission.
      ,
      • Meertens L.
      • Carnec X.
      • Lecoin M.P.
      • Ramdasi R.
      • Guivel-Benhassine F.
      • Lew E.
      • Lemke G.
      • Schwartz O.
      • Amara A.
      The TIM and TAM families of phosphatidylserine receptors mediate dengue virus entry.
      ,
      • Perera-Lecoin M.
      • Meertens L.
      • Carnec X.
      • Amara A.
      Flavivirus entry receptors: an update.
      ). DENV incorporates phosphatidylserine into its membrane to promote TIM- and TAM-mediated DENV infection (
      • Meertens L.
      • Carnec X.
      • Lecoin M.P.
      • Ramdasi R.
      • Guivel-Benhassine F.
      • Lew E.
      • Lemke G.
      • Schwartz O.
      • Amara A.
      The TIM and TAM families of phosphatidylserine receptors mediate dengue virus entry.
      ). TLR4-mediated LPS recognition requires the participation of MD2(27), a secreted glycoprotein that lacks a transmembrane structure. The binding of LPS to CD14, another co-receptor for complex involved in LPS recognition, is mediated by LPS binding protein (LBP) (
      • Van Amersfoort E.S.
      • Van Berkel T.J.
      • Kuiper J.
      Receptors, mediators, and mechanisms involved in bacterial sepsis and septic shock.
      ). Thus, LPS invades the host, binds the cell surface with the help of LBP/CD14 and then acts on TLR4 with the help of MD2. This results in signalling that activate the nuclear factor-κB (NF-κB) and mitogen-activated protein kinase signalling pathways, thereby promoting the activation of the expression of various inflammatory cytokine genes (
      • Yan Z-q
      Regulation of TLR4 expression is a tale about tail.
      ). Further research can explore whether cellular molecules that bind LPS, such as LBP, TLR4, MD2, or CD14, are present in the TMUV membrane. Studies have shown that there is also a receptor system consisting form multiple protein molecules (including CD14, TLR4, CXCR4, HSP70, HSP90, GDF5, etc.) on the cell surface (
      • Triantafilou M.
      • Brandenburg K.
      • Kusumoto S.
      • Fukase K.
      • Mackie A.
      • Seydel U.
      • Triantafilou K.
      Combinational clustering of receptors following stimulation by bacterial products determines lipopolysaccharide responses.
      ). LPS binds cells through this receptor system and participates in further signal transduction. The interaction between TMUV and that LPS receptor cluster is unknown. Given the complexity and importance of the system used for LPS recognition and signalling, it is remarkable that TMUV has an ability to use the complex (or, at the very least several of its components) to promote attachment of its virions to the cells without triggering anti-pathogen responses. This phenomenon warrants further studies that can promote our understanding not only about TMUV infection but also functioning of LPS receptor clusters.
      Interestingly, we found that the incubation of TMUV virions with LPS at 4 °C beyond 4 h seriously affected the infectivity of the virus. At higher temperatures, the negative impact of long-term incubation increased (Fig. 3F) but, importantly, beneficial effect of a short incubation time was maintained even at 42 °C (Fig. 3E). Notably, the body temperature of normal ducks is approximately 42 °C making these findings relevant to in vivo infection. Indeed, we observed that reducing intestinal flora affected TMUV infection when ducks were infected with gavage. The intestinal flora produces a large amount of LPS, which most likely supported TMUV infection.
      Collectively, our study identified LPS as novel facilitator of TMUV infection both in vitro and in vivo. Furthermore, our study shed light on the sophisticated TLR4-mediated effect on TMUV infection that was not limited to innate immune responses launched against virus invasion but also involved important role of TLR4 in TMUV attachment. These findings expand our knowledge of the role of commensal microbiota in regulating immunity in the intestinal mucosa during flavivirus infection. The oral transmission of TMUV was experimentally demonstrated. This phenomenon, currently rather unique for normally vector-transmitted viruses such as flaviviruses, warrants additional detailed studies that are currently hampered by the lack of required models. For example, TLR4 gene knockout ducks are needed for further studies the role of TLR4 and LPS in oral TMUV infection, which may expand our understanding of the non-vector transmission of TMUV in greater detail. We consider such studies highly important both from academic and practical points of view. As demonstrated here such studies have a potential to result in discovery of novel roles of host factors and to reveal complex interactions between host, virus and microbiota. It is also clear that existence of novel (or alternative) modes of transmission may significantly increase potential of viruses to spread and their understanding is therefore important to prevent or limit potential virus outbreaks.

      Experimental Procedures

      Cells and virus

      Baby hamster kidney cells (BHK-21, ATCC CCL-10) cells were grown in DMEM (Sigma–Aldrich, St. Louis, MO) containing 10% FBS. The duck primary cells used in this study were duck embryonic fibroblasts obtained from 10-day-old duck embryos and propagated in DMEM supplemented with 10% newborn calf serum (Life Technologies, Gaithersburg, MD). All cells were cultured in an incubator at 37 °C with 5% CO2. The duck TMUV strain CQW1 (GenBank accession number KM233707.1) has been previously reported (
      • Zhu K.
      • Huang J.
      • Jia R.
      • Zhang B.
      • Wang M.
      • Zhu D.
      • Chen S.
      • Liu M.
      • Yin Z.
      • Cheng A.
      Identification and molecular characterization of a novel duck Tembusu virus isolate from Southwest China.
      ); the titre of used TMUV stock was 107 TCID50/ml.

      Single-round infection virus particle (SRIP) preparation.

      SRIPs were prepared as previous described (
      • He Y.
      • Liu P.
      • Wang T.
      • Wu Y.
      • Lin X.
      • Wang M.
      • Jia R.
      • Zhu D.
      • Liu M.
      • Zhao X.
      • Yang Q.
      • Wu Y.
      • Zhang S.
      • Liu Y.
      • Zhang L.
      • Yu Y.
      • Pan L.
      • Chen S.
      • Cheng A.
      Genetically stable reporter virus, subgenomic replicon and packaging system of duck Tembusu virus based on a reverse genetics system.
      ). Briefly, BHK21 cells in a 12-well plate grown to 70–90% confluence were co-transfected with equal amounts of mC-Replicon-NLuc and pCDNA3.1-C16prME plasmids. After transfection, the cells were incubated at 37 °C with 5% CO2 for 4 days. The TMUV SRIP containing supernatants were harvested every day, aliquoted, and stored at −80 °C.

      Antibodies

      The antibodies against β-actin, GFP, strep II, and TLR4 purchased from ABclonal (Wuhan, China), and mouse anti-TMUV E monoclonal antibody (
      • Deng J.
      • Liu Y.
      • Jia R.
      • Wang M.
      • Chen S.
      • Zhu D.
      • Liu M.
      • Sun K.
      • Zhao X.
      • Yin Z.
      • Chen A.
      Development of an immunochromatographic strip for detection of antibodies against duck Tembusu virus.
      ) were used for immunoblotting experiemnts. The mouse polyclonal antibodies against NS3 of TMUV were generated in-house. The concentration of TLR4 antibody is 0.97 mg/mL.

      Duck treatments

      SPF duck embryos were purchased from Harbin Veterinary Research Institute, China. The ducklings were maintained in sterile isolators at Sichuan Agricultural University, ethical board of which approved all procedures. One-day-old SPF ducklings received an intragastric gavage of 500 μl of a mixture of the following antibiotics (Abx) at day 0: ampicillin (0.5 mg/ml), gentamicin (0.5 mg/ml), metronidazole (0.5 mg/ml), and neomycin (0.5 mg/ml) (all purchased from Sigma–Aldrich, St. Louis, MO); then, all antibiotic concentrations were increased to 1 mg/ml at day 5; antibiotic concentrations were increased to 2 mg/ml at day 10; antibiotic concentrations were increased to 10 mg/ml at day 15. The ducks were infected with 1×106TCID50 TMUV at day 20. Thus, in total the ducks were treated with Abx for a total of 20 days. A periodic bacteriologic examination of faeces was used to evaluate the efficacy of the antibiotic-treatment protocol. Fresh faecal samples were collected from the ducks after the twentieth day from beginning of treatment, homogenized, plated on Luria-Bertani (LB) agar plates with 10% sheep blood, and incubated under anaerobic conditions at 37 °C for 2 days, followed by incubation under aerobic conditions at 37 °C for 1 day.
      For the intestinal transit time assays, the ducks were gavaged with 2 ml of 8% Evans blue dye (Selleck, Houston, TX) after treatment of Abx at 20th day. Faecal samples were collected at 4, 12, and 24 hours, weighed, and resuspended in 0.1 g/ml sterilized PBS. The presence of dye was determined by reading the absorbance at 626 nm with a Multiskan Spectrum (Thermo Fisher Scientific).

      Cell infection, RNA extraction and RT–qPCR

      Duck primary cells were infected with TMUV. At the indicated times, the total RNA was extracted using RNAiso plus reagent (Takara, Dalian, China). The RNA was reverse transcribed with HiScript III-RT SuperMix (Vazyme, Nanjing, China) using random hexamer primers. The expression levels of the IL6, IFNbeta, OAS, and PKR genes were then quantified using the SYBR Green method (Abm, Richmond, BC, Canada) and a LightCycler 480 System instrument (Roche); mRNA copy numbers of these genes were normalized to the copy number of mRNA β-actin gene. The TMUV RNA copy numbers were detected by absolute quantitative PCR according to the real-time qPCR procedure previously established in our laboratory (
      • Wu Z.
      • Zhang W.
      • Wu Y.
      • Wang T.
      • Wu S.
      • Wang M.
      • Jia R.
      • Zhu D.
      • Liu M.
      • Zhao X.
      • Yang Q.
      • Wu Y.
      • Zhang S.
      • Liu Y.
      • Zhang L.
      • Yu Y.
      • Pan L.
      • Merits A.
      • Chen S.
      • Cheng A.
      Binding of the Duck Tembusu Virus Protease to STING Is Mediated by NS2B and Is Crucial for STING Cleavage and for Impaired Induction of IFN-beta.
      ).

      RNAi-mediated silencing of TLR4 expression

      The RNA interference (RNAi) constructs were designed using ThermoFisher RNAi target finder (http://rnaidesigner.thermofisher.com/rnaiexpress/). Sequences GCAACCTTCTATGGTTTAACACGAATGTTAAACCATAGAAGGTTGC and GCTACAGGTCAACAGACTAATCGAAATTAGTCTGTTGACCTGTAGC were constructed from oligonucleotides and cloned into the shRNA expression vector pGPU6-GFP-Neo, resulting in construct designated as shTLR4-124 and shTLR4-257, respectively. Plasmid designated as shNegative-124 (GCTTCCTACTATGGTAAAACACGAATGTTAAACCATAGAAGGTTGC) and shNegative-127 (GCAACAAATCAACTGACCAAGCGAAATTAGTCTGTTGACCTGTAGC) were constructed as negative control.

      Immunoblot analysis

      Cells were cultured in 12-well plates and harvested with lysis buffer containing a cocktail of protease and phosphatase inhibitors (Thermo Fisher Scientific). Equal amounts of the samples were then separated by SDS–PAGE using 10% polyacrylamide gels. Proteins were transferred to polyvinylidene difluoride (PVDF) membranes, incubated with appropriate primary and secondary antibodies, and visualized using an enhanced chemiluminescence system (Bio–Rad, Hercules, CA, USA). The expression of β-actin, which was used as a loading control, was detected with mouse anti-β-actin monoclonal antibody (Transgen Biotech, Beijing, China).

      Immunoprecipitation assays

      The immunoprecipitation (IP) assays were performed as previously described (
      • Wu Z.
      • Zhang W.
      • Wu Y.
      • Wang T.
      • Wu S.
      • Wang M.
      • Jia R.
      • Zhu D.
      • Liu M.
      • Zhao X.
      • Yang Q.
      • Wu Y.
      • Zhang S.
      • Liu Y.
      • Zhang L.
      • Yu Y.
      • Pan L.
      • Merits A.
      • Chen S.
      • Cheng A.
      Binding of the Duck Tembusu Virus Protease to STING Is Mediated by NS2B and Is Crucial for STING Cleavage and for Impaired Induction of IFN-beta.
      ). Briefly, cells were cultured in 60 mm plates and harvested by lysis in IP buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, and 1 mM EDTA supplemented with a protease inhibitor cocktail). A portion of the total lysates was retained as a whole-cell extract (WCE). For each IP reaction, 0.9 ml of the cell lysate were incubated with 30 μl of protein G-sepharose suspension (GE Healthcare) and 0.5 μg of antibody at 4 °C for 3 h. The protein G-sepharose beads were intensively washed with lysis buffer containing 0.5 M NaCl. The precipitates were then denatured and obtained samples were subjected to SDS–PAGE and an immunoblot analysis.

      Indirect immunofluorescence assays

      Duck primary cells or BHK-21 cells were seeded on coverslips that were placed in 6-well plates. When the cells reached approximately 70–90% confluence, they were co-transfected with the plasmids expressing duck Flag-tagged TLR4 and TMUV E protein fused with EGFP. At 24 h p.t. the cells were fixed in 4% paraformaldehyde for 1 h and permeabilized with 0.25% Triton X-100 for 1 h at 4 °C. After three washes with PBS, the cells were blocked with 5% bovine serum albumin in PBS for 1 h and then incubated with the mouse anti-Flag primary antibodies, washed, incubated with the secondary antibodies, washed again, and visualized under a Nikon 80i microscope (Japan) using magnification 600x.

      Recombinant TLR4 expression in mammalian cells and affinity purification

      The full-length coding sequence of duck TLR4 gene was amplified and fused with a sequence encoding for C-terminal strep II tag using overlapping PCR. The obtained sequence encoding TLR4-strep II tag sequence was inserted into a pCAGGS vector, for some experiments the strep II tag was replaced with Flag tag. The obtained plasmid was used in above described transfection and co-transfection experiments.
      To obtain recombinant TLR4 protein, HEK-293T cells were transfected with plasmid expressing TLR4 strep II using Lipofectamine 3000 (Thermo Fisher Scientific). The cells were harvested 48 h p.t. and broken using three freeze–thaw cycles. The obtained sample was centrifuged at 12,000×g for 10 min to remove cell debris. The TLR4-strep II protein was purified from obtained supernatant using strep-tactin sepharose according manufacturer’s (IBA) instructions.

      Statistical analysis

      The statistical analyses were performed and graphical images prepared using Prism 8 software (GraphPad Software). Unless otherwise stated, the results are shown as the means ± SD of three independent experiments and statistical significance was calculated using Student's t-test for pairwise comparisons. The statistically significant differences are indicated as follows: *p < .05; **p < .01; ***p < .001; ****p < .0001 and ns, not significant.

      Data Availability

      Raw MS data will be available upon request.

      Uncited reference

      • Mlcochova P.
      • Winstone H.
      • Zuliani-Alvarez L.
      • Gupta R.K.
      TLR4-Mediated Pathway Triggers Interferon-Independent G0 Arrest and Antiviral SAMHD1 Activity in Macrophages.
      ,
      • Modhiran N.
      • Watterson D.
      • Muller D.A.
      • Panetta A.K.
      • Sester D.P.
      • Liu L.
      • Hume D.A.
      • Stacey K.J.
      • Young P.R.
      Dengue virus NS1 protein activates cells via Toll-like receptor 4 and disrupts endothelial cell monolayer integrity.
      .

      Acknowledgements

      This work was funded by grants from the China Central and Eastern European countries joint education project (2021092), Sichuan Provincial Department of science and technology international scientific and technological innovation cooperation (2022YFH0026), the earmarked fund for China Agriculture Research System(CARS-42-17), and the Program Sichuan Veterinary Medicine and Drug Innovation Group of China Agricultural Research System (SCCXTD-2021-18).

      References

        • Zhang W.
        • Chen S.
        • Mahalingam S.
        • Wang M.
        • Cheng A.
        An updated review of avian-origin Tembusu virus: a newly emerging avian Flavivirus.
        J Gen Virol. 2017; 98: 2413-2420
        • Ninvilai P.
        • Tunterak W.
        • Oraveerakul K.
        • Amonsin A.
        • Thontiravong A.
        Genetic characterization of duck Tembusu virus in Thailand, 2015-2017: Identification of a novel cluster.
        Transbound Emerg Dis. 2019; 66: 1982-1992
        • Tang Y.
        • Gao X.
        • Diao Y.
        • Feng Q.
        • Chen H.
        • Liu X.
        • Ge P.
        • Yu C.
        Tembusu virus in human, China.
        Transbound Emerg Dis. 2013; 60: 193-196
        • Pulmanausahakul R.
        • Ketsuwan K.
        • Jaimipuk T.
        • Smith D.R.
        • Auewarakul P.
        • Songserm T.
        Detection of antibodies to duck tembusu virus in human population with or without the history of contact with ducks.
        Transbound Emerg Dis. 2021; https://doi.org/10.1111/tbed.13998
        • Li X.
        • Shi Y.
        • Liu Q.
        • Wang Y.
        • Li G.
        • Teng Q.
        • Zhang Y.
        • Liu S.
        • Li Z.
        Airborne Transmission of a Novel Tembusu Virus in Ducks.
        J Clin Microbiol. 2015; 53: 2734-2736
        • Ricklin M.E.
        • Garcia-Nicolas O.
        • Brechbuhl D.
        • Python S.
        • Zumkehr B.
        • Nougairede A.
        • Charrel R.N.
        • Posthaus H.
        • Oevermann A.
        • Summerfield A.
        Vector-free transmission and persistence of Japanese encephalitis virus in pigs.
        Nat Commun. 2016; 710832
        • Banet-Noach C.
        • Simanov L.
        • Malkinson M.
        Direct (non-vector) transmission of West Nile virus in geese.
        Avian Pathol. 2003; 32: 489-494
        • Kane M.
        • Case L.K.
        • Kopaskie K.
        • Kozlova A.
        • MacDearmid C.
        • Chervonsky A.V.
        • Golovkina T.V.
        Successful transmission of a retrovirus depends on the commensal microbiota.
        Science. 2011; 334: 245-249
        • Aguilera E.R.
        • Nguyen Y.
        • Sasaki J.
        • Pfeiffer J.K.
        Bacterial Stabilization of a Panel of Picornaviruses.
        mSphere. 2019; 4
        • Robinson C.M.
        • Jesudhasan P.R.
        • Pfeiffer J.K.
        Bacterial lipopolysaccharide binding enhances virion stability and promotes environmental fitness of an enteric virus.
        Cell Host Microbe. 2014; 15: 36-46
        • Ichinohe T.
        • Pang I.K.
        • Kumamoto Y.
        • Peaper D.R.
        • Ho J.H.
        • Murray T.S.
        • Iwasaki A.
        Microbiota regulates immune defense against respiratory tract influenza A virus infection.
        Proc Natl Acad Sci U S A. 2011; 108: 5354-5359
        • Bandoro C.
        • Runstadler J.A.
        Bacterial Lipopolysaccharide Destabilizes Influenza Viruses.
        mSphere. 2017; 2
        • Medzhitov R.
        • Preston-Hurlburt P.
        • Janeway Jr., C.A.
        A human homologue of the Drosophila Toll protein signals activation of adaptive immunity.
        Nature. 1997; 388: 394-397
        • Kawai T.
        • Akira S.
        The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors.
        Nature immunology. 2010; 11: 373-384
        • Harrison S.C.
        Viral membrane fusion.
        Nature structural & molecular biology. 2008; 15: 690-698
        • Chao C.-H.
        • Wu W.-C.
        • Lai Y.-C.
        • Tsai P.-J.
        • Perng G.-C.
        • Lin Y.-S.
        • Yeh T.-M.
        Dengue virus nonstructural protein 1 activates platelets via Toll-like receptor 4, leading to thrombocytopenia and hemorrhage.
        PLoS pathogens. 2019; 15e1007625
        • Wilks J.
        • Lien E.
        • Jacobson A.N.
        • Fischbach M.A.
        • Qureshi N.
        • Chervonsky A.V.
        • Golovkina T.V.
        Mammalian Lipopolysaccharide Receptors Incorporated into the Retroviral Envelope Augment Virus Transmission.
        Cell Host Microbe. 2015; 18: 456-462
        • Karst S.M.
        The influence of commensal bacteria on infection with enteric viruses.
        Nat Rev Microbiol. 2016; 14: 197-204
        • Langendries L.
        • Jacobs S.
        • Abdelnabi R.
        • Verwimp S.
        • Kaptein S.
        • Baatsen P.
        • Van Mellaert L.
        • Delang L.
        Perturbation of Alphavirus and Flavivirus Infectivity by Components of the Bacterial Cell Wall.
        J Virol. 2022; 96e0006022
        • Chen Y.C.
        • Wang S.Y.
        • King C.C.
        Bacterial lipopolysaccharide inhibits dengue virus infection of primary human monocytes/macrophages by blockade of virus entry via a CD14-dependent mechanism.
        J Virol. 1999; 73: 2650-2657
        • He Y.
        • Liu P.
        • Wang T.
        • Wu Y.
        • Lin X.
        • Wang M.
        • Jia R.
        • Zhu D.
        • Liu M.
        • Zhao X.
        • Yang Q.
        • Wu Y.
        • Zhang S.
        • Liu Y.
        • Zhang L.
        • Yu Y.
        • Pan L.
        • Chen S.
        • Cheng A.
        Genetically stable reporter virus, subgenomic replicon and packaging system of duck Tembusu virus based on a reverse genetics system.
        Virology. 2019; 533: 86-92
        • Ryu J.-K.
        • Kim S.J.
        • Rah S.-H.
        • Kang J.I.
        • Jung H.E.
        • Lee D.
        • Lee H.K.
        • Lee J.-O.
        • Park B.S.
        • Yoon T.-Y.
        • Kim H.M.
        Reconstruction of LPS Transfer Cascade Reveals Structural Determinants within LBP, CD14, and TLR4-MD2 for Efficient LPS Recognition and Transfer.
        Immunity. 2017; 46: 38-50
        • Nomura F.
        • Akashi S.
        • Sakao Y.
        • Sato S.
        • Kawai T.
        • Matsumoto M.
        • Nakanishi K.
        • Kimoto M.
        • Miyake K.
        • Takeda K.
        • Akira S.
        Cutting edge: endotoxin tolerance in mouse peritoneal macrophages correlates with down-regulation of surface toll-like receptor 4 expression.
        Journal of immunology. 2000; 164 (Baltimore, Md : 1950): 3476-3479
        • Lorenz E.
        • Mira J.P.
        • Frees K.L.
        • Schwartz D.A.
        Relevance of mutations in the TLR4 receptor in patients with gram-negative septic shock.
        Archives of internal medicine. 2002; 162: 1028-1032
        • Zacharowski K.
        • Zacharowski P.A.
        • Koch A.
        • Baban A.
        • Tran N.
        • Berkels R.
        • Papewalis C.
        • Schulze-Osthoff K.
        • Knuefermann P.
        • Zähringer U.
        • Schumann R.R.
        • Rettori V.
        • McCann S.M.
        • Bornstein S.R.
        Toll-like receptor 4 plays a crucial role in the immune-adrenal response to systemic inflammatory response syndrome.
        Proceedings of the National Academy of Sciences of the United States of America. 2006; 103: 6392-6397
        • Dejarnac O.
        • Hafirassou M.L.
        • Chazal M.
        • Versapuech M.
        • Gaillard J.
        • Perera-Lecoin M.
        • Umana-Diaz C.
        • Bonnet-Madin L.
        • Carnec X.
        • Tinevez J.Y.
        • Delaugerre C.
        • Schwartz O.
        • Roingeard P.
        • Jouvenet N.
        • Berlioz-Torrent C.
        • Meertens L.
        • Amara A.
        TIM-1 Ubiquitination Mediates Dengue Virus Entry.
        Cell Rep. 2018; 23: 1779-1793
        • Gangloff M.
        • Gay N.J.
        MD-2: the Toll 'gatekeeper' in endotoxin signalling.
        Trends in biochemical sciences. 2004; 29: 294-300
        • Aida Y.
        • Kusumoto K.
        • Nakatomi K.
        • Takada H.
        • Pabst M.J.
        • Maeda K.
        An analogue of lipid A and LPS from Rhodobacter sphaeroides inhibits neutrophil responses to LPS by blocking receptor recognition of LPS and by depleting LPS-binding protein in plasma.
        Journal of leukocyte biology. 1995; 58: 675-682
        • Teghanemt A.
        • Zhang D.
        • Levis E.N.
        • Weiss J.P.
        • Gioannini T.L.
        Molecular basis of reduced potency of underacylated endotoxins.
        Journal of immunology. 2005; 175 (Baltimore, Md : 1950): 4669-4676
        • Hirschfeld M.
        • Ma Y.
        • Weis J.H.
        • Vogel S.N.
        • Weis J.J.
        Cutting edge: repurification of lipopolysaccharide eliminates signaling through both human and murine toll-like receptor 2.
        J Immunol. 2000; 165: 618-622
        • Chen J.
        • Ng M.M.
        • Chu J.J.
        Activation of TLR2 and TLR6 by Dengue NS1 Protein and Its Implications in the Immunopathogenesis of Dengue Virus Infection.
        PLoS Pathog. 2015; 11e1005053
        • Netea M.G.
        • van der Graaf C.
        • Van der Meer J.W.M.
        • Kullberg B.J.
        Toll-like receptors and the host defense against microbial pathogens: bringing specificity to the innate-immune system.
        Journal of leukocyte biology. 2004; 75: 749-755
        • Lai C.-Y.
        • Strange D.P.
        • Wong T.A.S.
        • Lehrer A.T.
        • Verma S.
        Ebola Virus Glycoprotein Induces an Innate Immune Response via TLR4.
        Frontiers in microbiology. 2017; 8: 1571
        • Lagos D.
        • Vart R.J.
        • Gratrix F.
        • Westrop S.J.
        • Emuss V.
        • Wong P.P.
        • Robey R.
        • Imami N.
        • Bower M.
        • Gotch F.
        • Boshoff C.
        Toll-like receptor 4 mediates innate immunity to Kaposi sarcoma herpesvirus.
        Cell Host Microbe. 2008; 4: 470-483
        • Younan P.
        • Ramanathan P.
        • Graber J.
        • Gusovsky F.
        • Bukreyev A.
        The Toll-Like Receptor 4 Antagonist Eritoran Protects Mice from Lethal Filovirus Challenge.
        mBio. 2017; 8
        • Modhiran N.
        • Watterson D.
        • Blumenthal A.
        • Baxter A.G.
        • Young P.R.
        • Stacey K.J.
        Dengue virus NS1 protein activates immune cells via TLR4 but not TLR2 or TLR6.
        Immunology and cell biology. 2017; 95: 491-495
        • Glasner D.R.
        • Ratnasiri K.
        • Puerta-Guardo H.
        • Espinosa D.A.
        • Beatty P.R.
        • Harris E.
        Dengue virus NS1 cytokine-independent vascular leak is dependent on endothelial glycocalyx components.
        PLoS Pathog. 2017; 13e1006673
        • Marr N.
        • Turvey S.E.
        Role of human TLR4 in respiratory syncytial virus-induced NF-kappaB activation, viral entry and replication.
        Innate Immun. 2012; 18: 856-865
        • Mlcochova P.
        • Winstone H.
        • Zuliani-Alvarez L.
        • Gupta R.K.
        TLR4-Mediated Pathway Triggers Interferon-Independent G0 Arrest and Antiviral SAMHD1 Activity in Macrophages.
        Cell Rep. 2020; 30: 3972-3980 e5
        • Modhiran N.
        • Watterson D.
        • Muller D.A.
        • Panetta A.K.
        • Sester D.P.
        • Liu L.
        • Hume D.A.
        • Stacey K.J.
        • Young P.R.
        Dengue virus NS1 protein activates cells via Toll-like receptor 4 and disrupts endothelial cell monolayer integrity.
        Sci Transl Med. 2015; 7 (304ra142)
        • Kuss S.K.
        • Best G.T.
        • Etheredge C.A.
        • Pruijssers A.J.
        • Frierson J.M.
        • Hooper L.V.
        • Dermody T.S.
        • Pfeiffer J.K.
        Intestinal microbiota promote enteric virus replication and systemic pathogenesis.
        Science. 2011; 334: 249-252
        • Meertens L.
        • Carnec X.
        • Lecoin M.P.
        • Ramdasi R.
        • Guivel-Benhassine F.
        • Lew E.
        • Lemke G.
        • Schwartz O.
        • Amara A.
        The TIM and TAM families of phosphatidylserine receptors mediate dengue virus entry.
        Cell Host Microbe. 2012; 12: 544-557
        • Perera-Lecoin M.
        • Meertens L.
        • Carnec X.
        • Amara A.
        Flavivirus entry receptors: an update.
        Viruses. 2013; 6: 69-88
        • Van Amersfoort E.S.
        • Van Berkel T.J.
        • Kuiper J.
        Receptors, mediators, and mechanisms involved in bacterial sepsis and septic shock.
        Clin Microbiol Rev. 2003; 16: 379-414
        • Yan Z-q
        Regulation of TLR4 expression is a tale about tail.
        Arteriosclerosis, thrombosis, and vascular biology. 2006; 26: 2582-2584
        • Triantafilou M.
        • Brandenburg K.
        • Kusumoto S.
        • Fukase K.
        • Mackie A.
        • Seydel U.
        • Triantafilou K.
        Combinational clustering of receptors following stimulation by bacterial products determines lipopolysaccharide responses.
        Biochem J. 2004; 381: 527-536
        • Zhu K.
        • Huang J.
        • Jia R.
        • Zhang B.
        • Wang M.
        • Zhu D.
        • Chen S.
        • Liu M.
        • Yin Z.
        • Cheng A.
        Identification and molecular characterization of a novel duck Tembusu virus isolate from Southwest China.
        Arch Virol. 2015; 160: 2781-2790
        • Deng J.
        • Liu Y.
        • Jia R.
        • Wang M.
        • Chen S.
        • Zhu D.
        • Liu M.
        • Sun K.
        • Zhao X.
        • Yin Z.
        • Chen A.
        Development of an immunochromatographic strip for detection of antibodies against duck Tembusu virus.
        J Virol Methods. 2017; 249: 137-142
        • Wu Z.
        • Zhang W.
        • Wu Y.
        • Wang T.
        • Wu S.
        • Wang M.
        • Jia R.
        • Zhu D.
        • Liu M.
        • Zhao X.
        • Yang Q.
        • Wu Y.
        • Zhang S.
        • Liu Y.
        • Zhang L.
        • Yu Y.
        • Pan L.
        • Merits A.
        • Chen S.
        • Cheng A.
        Binding of the Duck Tembusu Virus Protease to STING Is Mediated by NS2B and Is Crucial for STING Cleavage and for Impaired Induction of IFN-beta.
        J Immunol. 2019; 203: 3374-3385