Advertisement

Nanobody derived using a peptide epitope from the Spike protein receptor-binding motif inhibits entry of SARS-CoV-2 variants

  • Author Footnotes
    # These authors contributed equally
    Nivya Mendon
    Footnotes
    # These authors contributed equally
    Affiliations
    Centre for Cardiovascular Biology and Disease, Institute for Stem Cell Science and Regenerative Medicine, GKVK Campus, Bengaluru-560065, India

    Manipal Academy of Higher Education, Manipal-576104, Karnataka, India
    Search for articles by this author
  • Author Footnotes
    # These authors contributed equally
    Rayees Ganie
    Footnotes
    # These authors contributed equally
    Affiliations
    Centre for Cardiovascular Biology and Disease, Institute for Stem Cell Science and Regenerative Medicine, GKVK Campus, Bengaluru-560065, India

    Manipal Academy of Higher Education, Manipal-576104, Karnataka, India
    Search for articles by this author
  • Author Footnotes
    # These authors contributed equally
    Shubham Kesarwani
    Footnotes
    # These authors contributed equally
    Affiliations
    Centre for Cardiovascular Biology and Disease, Institute for Stem Cell Science and Regenerative Medicine, GKVK Campus, Bengaluru-560065, India
    Search for articles by this author
  • Drisya Dileep
    Affiliations
    Centre for Cardiovascular Biology and Disease, Institute for Stem Cell Science and Regenerative Medicine, GKVK Campus, Bengaluru-560065, India

    The University of Trans-Disciplinary Health Sciences and Technology (TDU), Bengaluru-560064, India
    Search for articles by this author
  • Sarika Sasi
    Affiliations
    Centre for Cardiovascular Biology and Disease, Institute for Stem Cell Science and Regenerative Medicine, GKVK Campus, Bengaluru-560065, India
    Search for articles by this author
  • Prakash Lama
    Affiliations
    Centre for Cardiovascular Biology and Disease, Institute for Stem Cell Science and Regenerative Medicine, GKVK Campus, Bengaluru-560065, India

    Manipal Academy of Higher Education, Manipal-576104, Karnataka, India
    Search for articles by this author
  • Anchal Chandra
    Affiliations
    National Centre for Biological Sciences, TIFR, GKVK Campus, Bengaluru-560065, India
    Search for articles by this author
  • Minhajuddin Sirajuddin
    Correspondence
    Address correspondence to M. Sirajuddin:
    Affiliations
    Centre for Cardiovascular Biology and Disease, Institute for Stem Cell Science and Regenerative Medicine, GKVK Campus, Bengaluru-560065, India
    Search for articles by this author
  • Author Footnotes
    # These authors contributed equally
Open AccessPublished:November 21, 2022DOI:https://doi.org/10.1016/j.jbc.2022.102732

      Abstract

      The emergence of new escape mutants of the SARS-CoV-2 virus has escalated its penetration among the human population and has reinstated its status as a global pandemic. Therefore, developing effective antiviral therapy against emerging SARS-CoV variants and other viruses in a short period of time becomes essential. Blocking SARS-CoV-2 entry into human host cells by disrupting the Spike glycoprotein-angiotensin-converting enzyme 2 (ACE2) interaction has already been exploited for vaccine development and monoclonal antibody therapy. Unlike the previous reports, our study used a nine-amino acid peptide from the receptor-binding motif (RBM) of the Spike (S) protein as an epitope. We report the identification of an efficacious nanobody N1.2 that blocks the entry of pseudovirus-containing SARS-CoV-2 Spike as the surface glycoprotein. Moreover, using mCherry fluorescence based reporter assay we observe a more potent neutralizing effect against both the hCoV19 (Wuhan/WIV04/2019) and the Omicron (BA.1) pseudotyped Spike virus with a bivalent version of the N1.2 nanobody. In summary, our study presents a rapid, and efficient methodology to use peptide sequences from a protein-receptor interaction interface as epitopes for screening nanobodies against potential pathogenic targets. We propose that this approach can also be widely extended to target other viruses and pathogens in the future.

      Keywords

      Introduction

      The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) belongs to the betacoronavirus family and is the third member of the family after MERS-CoV and SARS-CoV that has infected the human population, resulting in moderate to severe pathogenic symptoms (
      • Tang D.
      • Comish P.
      • Kang R.
      The hallmarks of COVID-19 disease.
      ). With the frequent outbreaks of new variants, these numbers are increasing every day (
      • Xu Z.
      • Liu K.
      • Gao G.F.
      Omicron variant of SARS-CoV-2 imposes a new challenge for the global public health.
      ). Although several safe and effective anti-SARS-CoV-2 therapies exist, which can prevent severe symptoms upon infection, none of them has been proven to be 100% effective. Partial vaccination, in turn, has put the SARS-CoV-2 virus under increased selection pressure resulting in a high mutation rate in the viral Spike protein (
      • Cobey S.
      • Larremore D.B.
      • Grad Y.H.
      • Lipsitch M.
      Concerns about SARS-CoV-2 evolution should not hold back efforts to expand vaccination.
      ). With the emergence of novel variants and escape mutants of SARS-CoV-2, there is an urgent need to develop effective antiviral therapy that can function as a panacea for both the current and emerging variants.
      The surface of the SARS-CoV-2 virus is decorated with homotrimer Spike (S) envelope glycoprotein, the major antigenic determinant of the host immune response and one of the main coronavirus drug targets (
      • He Y.
      • Lu H.
      • Siddiqui P.
      • Zhou Y.
      • Jiang S.
      (2005) Receptor-binding domain of severe acute respiratory syndrome coronavirus spike protein contains multiple conformation-dependent epitopes that induce highly potent neutralizing antibodies.
      ). The SARS-CoV-2 entry is orchestrated by the interaction of the receptor-binding domain (RBD) of its Spike with the angiotensin-converting enzyme 2 (ACE2) receptor on the host cell membrane (
      • Lan J.
      • Ge J.
      • Yu J.
      • Shan S.
      • Zhou H.
      • Fan S.
      • Zhang Q.
      • Shi X.
      • Wang Q.
      • Zhang L.
      • Wang X.
      Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor.
      ,
      • Walls A.C.
      • Park Y.-J.
      • Tortorici M.A.
      • Wall A.
      • McGuire A.T.
      • Veesler D.
      Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein.
      ). The interaction is established by a set of conserved residues present in the receptor-binding motif (RBM) of the Spike (
      • Shang J.
      • Wan Y.
      • Luo C.
      • Ye G.
      • Geng Q.
      • Auerbach A.
      • Li F.
      Cell entry mechanisms of SARS-CoV-2.
      ). Efforts have been made to prevent this first step of infection using antibodies or nanobodies that target the Spike-ACE2 interaction (
      • Custódio T.F.
      • Das H.
      • Sheward D.J.
      • Hanke L.
      • Pazicky S.
      • Pieprzyk J.
      • Sorgenfrei M.
      • Schroer M.A.
      • Gruzinov A.Y.
      • Jeffries C.M.
      • Graewert M.A.
      • Svergun D.I.
      • Dobrev N.
      • Remans K.
      • Seeger M.A.
      • McInerney G.M.
      • Murrell B.
      • Hällberg B.M.
      • Löw C.
      Selection, biophysical and structural analysis of synthetic nanobodies that effectively neutralize SARS-CoV-2.
      ,
      • Hanke L.
      • Vidakovics Perez L.
      • Sheward D.J.
      • Das H.
      • Schulte T.
      • Moliner-Morro A.
      • Corcoran M.
      • Achour A.
      • Karlsson Hedestam G.B.
      • Hällberg B.M.
      • Murrell B.
      • McInerney G.M.
      An alpaca nanobody neutralizes SARS-CoV-2 by blocking receptor interaction.
      ,

      Huo, J., Bas, A. L., Ruza, R., Duyvesteyn, H. M. E., Mikolajek, H., Malinauskas, T., Tan, T. K., Rijal, P., Dumoux, M., Ward, P., Ren, J., Zhou, D., Harrison, P., Radeke, J., Zhao, Y., Gilbert-Jaramillo, J., Knight, M., Carrique, L., Shah, P. N. M., James, W., Townsend, A., Stuart, D., Owens, R., and Naismith, J. (2020) Structural characterisation of a nanobody derived from a naïve library that neutralises SARS-CoV-2. 10.21203/rs.3.rs-32948/v1

      ,
      • Mast F.D.
      • Fridy P.C.
      • Ketaren N.E.
      • Wang J.
      • Jacobs E.Y.
      • Olivier J.P.
      • Sanyal T.
      • Molloy K.R.
      • Schmidt F.
      • Rutkowska M.
      • Weisblum Y.
      • Rich L.M.
      • Vanderwall E.R.
      • Dambrauskas N.
      • Vigdorovich V.
      • Keegan S.
      • Jiler J.B.
      • Stein M.E.
      • Olinares P.D.B.
      • Herlands L.
      • Hatziioannou T.
      • Sather D.N.
      • Debley J.S.
      • FenyӦ D.
      • Sali A.
      • Bieniasz P.D.
      • Aitchison J.D.
      • Chait B.T.
      • Rout M.P.
      Highly synergistic combinations of nanobodies that target SARS-CoV-2 and are resistant to escape.
      ,
      • Shi R.
      • Shan C.
      • Duan X.
      • Chen Z.
      • Liu P.
      • Song J.
      • Song T.
      • Bi X.
      • Han C.
      • Wu L.
      • Gao G.
      • Hu X.
      • Zhang Y.
      • Tong Z.
      • Huang W.
      • Liu W.J.
      • Wu G.
      • Zhang B.
      • Wang L.
      • Qi J.
      • Feng H.
      • Wang F.-S.
      • Wang Q.
      • Gao G.F.
      • Yuan Z.
      • Yan J.
      A human neutralizing antibody targets the receptor-binding site of SARS-CoV-2.
      ,
      • Wang C.
      • Li W.
      • Drabek D.
      • Okba N.M.A.
      • van Haperen R.
      • Osterhaus A.D.M.E.
      • van Kuppeveld F.J.M.
      • Haagmans B.L.
      • Grosveld F.
      • Bosch B.-J.
      A human monoclonal antibody blocking SARS-CoV-2 infection.
      ,
      • Wrapp D.
      • De Vlieger D.
      • Corbett K.S.
      • Torres G.M.
      • Wang N.
      • Van Breedam W.
      • Roose K.
      • van Schie L.
      • Hoffmann M.
      • Pöhlmann S.
      • Graham B.S.
      • Callewaert N.
      • Schepens B.
      • Saelens X.
      • McLellan J.S.
      VIB-CMB COVID-19 Response Team
      Structural Basis for Potent Neutralization of Betacoronaviruses by Single-Domain Camelid Antibodies.
      ,
      • Xiang Y.
      • Nambulli S.
      • Xiao Z.
      • Liu H.
      • Sang Z.
      • Duprex W.P.
      • Schneidman-Duhovny D.
      • Zhang C.
      • Shi Y.
      Versatile and multivalent nanobodies efficiently neutralize SARS-CoV-2.
      ,
      • Ye M.
      • Fu D.
      • Ren Y.
      • Wang F.
      • Wang D.
      • Zhang F.
      • Xia X.
      • Lv T.
      Treatment with convalescent plasma for COVID-19 patients in Wuhan, China.
      ,
      • Schoof M.
      • Faust B.
      • Saunders R.A.
      • Sangwan S.
      • Rezelj V.
      • Hoppe N.
      • Boone M.
      • Billesbølle C.B.
      • Puchades C.
      • Azumaya C.M.
      • Kratochvil H.T.
      • Zimanyi M.
      • Deshpande I.
      • Liang J.
      • Dickinson S.
      • Nguyen H.C.
      • Chio C.M.
      • Merz G.E.
      • Thompson M.C.
      • Diwanji D.
      • Schaefer K.
      • Anand A.A.
      • Dobzinski N.
      • Zha B.S.
      • Simoneau C.R.
      • Leon K.
      • White K.M.
      • Chio U.S.
      • Gupta M.
      • Jin M.
      • Li F.
      • Liu Y.
      • Zhang K.
      • Bulkley D.
      • Sun M.
      • Smith A.M.
      • Rizo A.N.
      • Moss F.
      • Brilot A.F.
      • Pourmal S.
      • Trenker R.
      • Pospiech T.
      • Gupta S.
      • Barsi-Rhyne B.
      • Belyy V.
      • Barile-Hill A.W.
      • Nock S.
      • Liu Y.
      • Krogan N.J.
      • Ralston C.Y.
      • Swaney D.L.
      • García-Sastre A.
      • Ott M.
      • Vignuzzi M.
      • Walter P.
      • Manglik A.
      QCRG Structural Biology Consortium
      An ultrapotent synthetic nanobody neutralizes SARS-CoV-2 by stabilizing inactive Spike.
      ). Several groups have also isolated antibodies directly from convalescent SARS-CoV-2 patients that showed promising neutralization against SARS-CoV-2 in-vitro and improved clinical outcomes in tested animals in vivo (
      • B Z.
      • S L.
      • T T.
      • W H.
      • Y D.
      • L C.
      • Q C.
      • L Z.
      • Q Z.
      • X Z.
      • Y Z.
      • S Z.
      Treatment With Convalescent Plasma for Critically Ill Patients With Severe Acute Respiratory Syndrome Coronavirus 2 Infection.
      ,
      • Cao Y.
      • Su B.
      • Guo X.
      • Sun W.
      • Deng Y.
      • Bao L.
      • Zhu Q.
      • Zhang X.
      • Zheng Y.
      • Geng C.
      • Chai X.
      • He R.
      • Li X.
      • Lv Q.
      • Zhu H.
      • Deng W.
      • Xu Y.
      • Wang Y.
      • Qiao L.
      • Tan Y.
      • Song L.
      • Wang G.
      • Du X.
      • Gao N.
      • Liu J.
      • Xiao J.
      • Su X.-D.
      • Du Z.
      • Feng Y.
      • Qin C.
      • Qin C.
      • Jin R.
      • Xie X.S.
      Potent Neutralizing Antibodies against SARS-CoV-2 Identified by High-Throughput Single-Cell Sequencing of Convalescent Patients’ B Cells.
      ,
      • Minenkova O.
      • Santapaola D.
      • Milazzo F.M.
      • Anastasi A.M.
      • Battistuzzi G.
      • Chiapparino C.
      • Rosi A.
      • Gritti G.
      • Borleri G.
      • Rambaldi A.
      • Dental C.
      • Viollet C.
      • Pagano B.
      • Salvini L.
      • Marra E.
      • Luberto L.
      • Rossi A.
      • Riccio A.
      • Pich E.M.
      • Santoro M.G.
      • Santis R.D.
      Human inhalable antibody fragments neutralizing SARS-CoV-2 variants for COVID-19 therapy.
      ,
      • Shen C.
      • Wang Z.
      • Zhao F.
      • Yang Y.
      • Li J.
      • Yuan J.
      • Wang F.
      • Li D.
      • Yang M.
      • Xing L.
      • Wei J.
      • Xiao H.
      • Yang Y.
      • Qu J.
      • Qing L.
      • Chen L.
      • Xu Z.
      • Peng L.
      • Li Y.
      • Zheng H.
      • Chen F.
      • Huang K.
      • Jiang Y.
      • Liu D.
      • Zhang Z.
      • Liu Y.
      • Liu L.
      Treatment of 5 Critically Ill Patients With COVID-19 With Convalescent Plasma.
      ,
      • Wu X.
      • Cheng L.
      • Fu M.
      • Huang B.
      • Zhu L.
      • Xu S.
      • Shi H.
      • Zhang D.
      • Yuan H.
      • Nawaz W.
      • Yang P.
      • Hu Q.
      • Liu Y.
      • Wu Z.
      A potent bispecific nanobody protects hACE2 mice against SARS-CoV-2 infection via intranasal administration.
      ,
      • Ye G.
      • Gallant J.
      • Zheng J.
      • Massey C.
      • Shi K.
      • Tai W.
      • Odle A.
      • Vickers M.
      • Shang J.
      • Wan Y.
      • Du L.
      • Aihara H.
      • Perlman S.
      • LeBeau A.
      • Li F.
      The development of Nanosota-1 as anti-SARS-CoV-2 nanobody drug candidates.
      ). Nanobodies, on the other hand, offer many advantages over conventional antibodies in terms of their size, high thermal stability, solubility, and ease of expression in bacteria hence making them easily scalable and cost-effective therapies (
      • Muyldermans S.
      Nanobodies: natural single-domain antibodies.
      ). Nanobodies, which are derived from the variable domain of the camelid heavy chain, retain specificity and affinity similar to conventional antibodies. Modularity in nanobodies allows oligomerization hence increasing their avidity and serum shelf life (
      • Bannas P.
      • Hambach J.
      • Koch-Nolte F.
      Nanobodies and Nanobody-Based Human Heavy Chain Antibodies As Antitumor Therapeutics.
      ). Nanobodies can be easily humanized which is critical for developing antiviral therapies for humans (
      • Vincke C.
      • Loris R.
      • Saerens D.
      • Martinez-Rodriguez S.
      • Muyldermans S.
      • Conrath K.
      General strategy to humanize a camelid single-domain antibody and identification of a universal humanized nanobody scaffold.
      ). Treatment with combinatorial nanobodies has been effective in neutralizing SARS-CoV-2 and preventing mutational escape (
      • Mast F.D.
      • Fridy P.C.
      • Ketaren N.E.
      • Wang J.
      • Jacobs E.Y.
      • Olivier J.P.
      • Sanyal T.
      • Molloy K.R.
      • Schmidt F.
      • Rutkowska M.
      • Weisblum Y.
      • Rich L.M.
      • Vanderwall E.R.
      • Dambrauskas N.
      • Vigdorovich V.
      • Keegan S.
      • Jiler J.B.
      • Stein M.E.
      • Olinares P.D.B.
      • Herlands L.
      • Hatziioannou T.
      • Sather D.N.
      • Debley J.S.
      • FenyӦ D.
      • Sali A.
      • Bieniasz P.D.
      • Aitchison J.D.
      • Chait B.T.
      • Rout M.P.
      Highly synergistic combinations of nanobodies that target SARS-CoV-2 and are resistant to escape.
      ). Many of such anti-SARS-CoV-2 therapies report the use of the entire Spike protein or its RBD domain as the epitope to screen active antiviral antibodies (
      • Custódio T.F.
      • Das H.
      • Sheward D.J.
      • Hanke L.
      • Pazicky S.
      • Pieprzyk J.
      • Sorgenfrei M.
      • Schroer M.A.
      • Gruzinov A.Y.
      • Jeffries C.M.
      • Graewert M.A.
      • Svergun D.I.
      • Dobrev N.
      • Remans K.
      • Seeger M.A.
      • McInerney G.M.
      • Murrell B.
      • Hällberg B.M.
      • Löw C.
      Selection, biophysical and structural analysis of synthetic nanobodies that effectively neutralize SARS-CoV-2.
      ,
      • Hanke L.
      • Vidakovics Perez L.
      • Sheward D.J.
      • Das H.
      • Schulte T.
      • Moliner-Morro A.
      • Corcoran M.
      • Achour A.
      • Karlsson Hedestam G.B.
      • Hällberg B.M.
      • Murrell B.
      • McInerney G.M.
      An alpaca nanobody neutralizes SARS-CoV-2 by blocking receptor interaction.
      ,

      Huo, J., Bas, A. L., Ruza, R., Duyvesteyn, H. M. E., Mikolajek, H., Malinauskas, T., Tan, T. K., Rijal, P., Dumoux, M., Ward, P., Ren, J., Zhou, D., Harrison, P., Radeke, J., Zhao, Y., Gilbert-Jaramillo, J., Knight, M., Carrique, L., Shah, P. N. M., James, W., Townsend, A., Stuart, D., Owens, R., and Naismith, J. (2020) Structural characterisation of a nanobody derived from a naïve library that neutralises SARS-CoV-2. 10.21203/rs.3.rs-32948/v1

      ,
      • Mast F.D.
      • Fridy P.C.
      • Ketaren N.E.
      • Wang J.
      • Jacobs E.Y.
      • Olivier J.P.
      • Sanyal T.
      • Molloy K.R.
      • Schmidt F.
      • Rutkowska M.
      • Weisblum Y.
      • Rich L.M.
      • Vanderwall E.R.
      • Dambrauskas N.
      • Vigdorovich V.
      • Keegan S.
      • Jiler J.B.
      • Stein M.E.
      • Olinares P.D.B.
      • Herlands L.
      • Hatziioannou T.
      • Sather D.N.
      • Debley J.S.
      • FenyӦ D.
      • Sali A.
      • Bieniasz P.D.
      • Aitchison J.D.
      • Chait B.T.
      • Rout M.P.
      Highly synergistic combinations of nanobodies that target SARS-CoV-2 and are resistant to escape.
      ,
      • Shi R.
      • Shan C.
      • Duan X.
      • Chen Z.
      • Liu P.
      • Song J.
      • Song T.
      • Bi X.
      • Han C.
      • Wu L.
      • Gao G.
      • Hu X.
      • Zhang Y.
      • Tong Z.
      • Huang W.
      • Liu W.J.
      • Wu G.
      • Zhang B.
      • Wang L.
      • Qi J.
      • Feng H.
      • Wang F.-S.
      • Wang Q.
      • Gao G.F.
      • Yuan Z.
      • Yan J.
      A human neutralizing antibody targets the receptor-binding site of SARS-CoV-2.
      ,
      • Wang C.
      • Li W.
      • Drabek D.
      • Okba N.M.A.
      • van Haperen R.
      • Osterhaus A.D.M.E.
      • van Kuppeveld F.J.M.
      • Haagmans B.L.
      • Grosveld F.
      • Bosch B.-J.
      A human monoclonal antibody blocking SARS-CoV-2 infection.
      ,
      • Wrapp D.
      • De Vlieger D.
      • Corbett K.S.
      • Torres G.M.
      • Wang N.
      • Van Breedam W.
      • Roose K.
      • van Schie L.
      • Hoffmann M.
      • Pöhlmann S.
      • Graham B.S.
      • Callewaert N.
      • Schepens B.
      • Saelens X.
      • McLellan J.S.
      VIB-CMB COVID-19 Response Team
      Structural Basis for Potent Neutralization of Betacoronaviruses by Single-Domain Camelid Antibodies.
      ,
      • Xiang Y.
      • Nambulli S.
      • Xiao Z.
      • Liu H.
      • Sang Z.
      • Duprex W.P.
      • Schneidman-Duhovny D.
      • Zhang C.
      • Shi Y.
      Versatile and multivalent nanobodies efficiently neutralize SARS-CoV-2.
      ,
      • Ye M.
      • Fu D.
      • Ren Y.
      • Wang F.
      • Wang D.
      • Zhang F.
      • Xia X.
      • Lv T.
      Treatment with convalescent plasma for COVID-19 patients in Wuhan, China.
      ,
      • Schoof M.
      • Faust B.
      • Saunders R.A.
      • Sangwan S.
      • Rezelj V.
      • Hoppe N.
      • Boone M.
      • Billesbølle C.B.
      • Puchades C.
      • Azumaya C.M.
      • Kratochvil H.T.
      • Zimanyi M.
      • Deshpande I.
      • Liang J.
      • Dickinson S.
      • Nguyen H.C.
      • Chio C.M.
      • Merz G.E.
      • Thompson M.C.
      • Diwanji D.
      • Schaefer K.
      • Anand A.A.
      • Dobzinski N.
      • Zha B.S.
      • Simoneau C.R.
      • Leon K.
      • White K.M.
      • Chio U.S.
      • Gupta M.
      • Jin M.
      • Li F.
      • Liu Y.
      • Zhang K.
      • Bulkley D.
      • Sun M.
      • Smith A.M.
      • Rizo A.N.
      • Moss F.
      • Brilot A.F.
      • Pourmal S.
      • Trenker R.
      • Pospiech T.
      • Gupta S.
      • Barsi-Rhyne B.
      • Belyy V.
      • Barile-Hill A.W.
      • Nock S.
      • Liu Y.
      • Krogan N.J.
      • Ralston C.Y.
      • Swaney D.L.
      • García-Sastre A.
      • Ott M.
      • Vignuzzi M.
      • Walter P.
      • Manglik A.
      QCRG Structural Biology Consortium
      An ultrapotent synthetic nanobody neutralizes SARS-CoV-2 by stabilizing inactive Spike.
      ). A limitation of using the entire Spike protein or RBD as an epitope is that the isolated antibodies may bind to different regions of Spike protein other than the ACE2 interacting domain, thus rendering them unspecific and inefficient in fully neutralizing the viral infection. Here, we report the isolation of a nanobody (N1.2) from a yeast nanobody display library using a nine amino acid peptide sequence as a target epitope. The peptide was designed from the specific residues present in the RBM of Spike protein showing maximum interaction with the ACE2 receptor. This nanobody, both the monomer as well as the tandem dimer, interferes with ACE2 binding, thus showing a potent virus neutralization activity in cellular models.

      Results

      Screening and identification of anti-Spike nanobodies

      SARS-CoV-2 interacts with the cellular ACE2 (angiotensin-converting enzyme 2) receptor in the host cell plasma membrane via its trimeric Spike envelope protein to gain access to the cytoplasm (Fig. 1A). We designed two peptide sequences from the Spike envelope protein; peptide-1 (residues 486-494) and peptide-2 (residues 496 – 505) from the RBM of hCoV19 (Wuhan/WIV04/2019) (
      • Lan J.
      • Ge J.
      • Yu J.
      • Shan S.
      • Zhou H.
      • Fan S.
      • Zhang Q.
      • Shi X.
      • Wang Q.
      • Zhang L.
      • Wang X.
      Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor.
      ). The choice of these two peptides were based on contact site and strength of interaction of RBD with ACE2. The 19 residue RBM stretch encompassing both the peptides has the maximum interaction sites with ACE2, which involves 9 hydrogen bonds (
      • Lan J.
      • Ge J.
      • Yu J.
      • Shan S.
      • Zhou H.
      • Fan S.
      • Zhang Q.
      • Shi X.
      • Wang Q.
      • Zhang L.
      • Wang X.
      Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor.
      ). Additionally, the RBM stretch is devoid of glycosylation sites reported so far in the analysis of SARS-CoV-2 spike protein (
      • Ghorbani M.
      • Brooks B.R.
      • Klauda J.B.
      Exploring dynamics and network analysis of spike glycoprotein of SARS-COV-2.
      ), thus making the peptides an ideal candidate for nanobody screening. These peptides were used as bait (epitope) to enrich potential nanobody sequences from the combinatorial yeast display library (
      • McMahon C.
      • Baier A.S.
      • Pascolutti R.
      • Wegrecki M.
      • Zheng S.
      • Ong J.X.
      • Erlandson S.C.
      • Hilger D.
      • Rasmussen S.G.F.
      • Ring A.M.
      • Manglik A.
      • Kruse A.C.
      Yeast surface display platform for rapid discovery of conformationally selective nanobodies.
      ). The screening methodology involves two rounds of magnetic screening followed by fluorescent activated cell sorting (FACS) based enrichment of the library (Fig. 1B). From the FACS analysis, only peptide-1 showed positive enrichment of the nanobody clones (Fig. 1B). Therefore, from here onwards we focused only on the nanobody population obtained from the peptide-1 screen. After FACS, the enriched yeast clones were individually analyzed using sequencing. Ten unique nanobody sequences were identified and purified, named N1.1 to N1.10 for further characterization (Fig. S1 and Table S1) (Experimental Procedures).
      Figure thumbnail gr1
      Figure 1Identification of nanobodies against Spike protein using peptides. A. Schematic illustration of SARS-CoV-2 virus entry into the host cell through ACE2 receptor. Cartoon model of molecular interaction between Spike- and RBD-ACE2 derived from PDB ID: 6VXX and 6LZG, respectively. The Receptor Binding Motif (RBM) is highlighted in red in the ribbon model and sequence, and the peptide-1 and -2 sequences are underscored and indicated B. Representative images for peptide-1 and -2 sorting data on BD FACS Aria fusion cell sorter, the nanobody library labelled using anti HAmarker in Alexa fluor-647 channel, and the peptides with streptavidin FITC. The P2 quadrant represents the double labelled yeast population indicating the extent of enrichment of yeast clones that has an affinity towards the respective peptide. C. ELISA assay of purified nanobodies against the peptide-1, -2, and tyrosinated alpha-tubulin CTT peptide are shown as scatter plots with average values as column bar with error bar representing standard deviation. N=2. The A1aY1 protein against tyrosinated alpha-tubulin CTT peptide was included as an assay control.
      These purified nanobodies were subjected to ELISA for characterizing the interaction with peptide-1 and -2 (Experimental Procedures). All the nanobodies showed binding with the peptide-1 compared to the peptide-2, except N1.4 (Fig. 1C), suggesting that the enriched nanobody clones N1.1 to N1.10 are specific toward the peptide-1 epitope.

      Characterization of nanobodies using flow cytometry-based cellular assay

      We then tested each of the purified nanobodies for their ability to block Spike: ACE2 interaction using a pseudovirus-based neutralizing assay (Fig. 2A). Pseudoviruses displaying Spike envelope glycoprotein with a mCherry reporter were generated (
      • Chen M.
      • Zhang X.-E.
      Construction and applications of SARS-CoV-2 pseudoviruses: a mini review.
      ) (Experimental Procedures). The viral infectivity was assessed using the mCherry expression, which was further quantified using fluorescence measurement (Experimental Procedures).
      Figure thumbnail gr2
      Figure 2Characterization of nanobodies using virus entry assay. A. Cartoon representation of the virus entry assay using Spike pseudovirus. The pseudoviruses contain the mCherry gene in their genome and upon entering the eGFP-ACE2/HEK293T cell the mCherry will be expressed and the fluorescence can be used for quantification of the virus infection. B. Maximum intensity Z-projection of confocal images obtained from eGFP-ACE2/HEK293T, ACE2-SNAP-FLAG (magenta), eGFP (green), and nucleus (blue). Scale bar = 10 microns. C. FACS-based quantification of Spike pseudovirus infection into eGFP-ACE2/HEK293T (magenta) in the presence of various nanobodies as indicated (Experimental Procedures). The percentage of infectivity is normalized to the percentage of mCherry positive cells in the absence of nanobody in the assay. For raw FACS data and details regarding the assay, refer to and Experimental Procedures.
      Since the ACE2 expression in HEK293T cells is lower compared to other cell lines (
      • Hoffmann M.
      • Kleine-Weber H.
      • Schroeder S.
      • Krüger N.
      • Herrler T.
      • Erichsen S.
      • Schiergens T.S.
      • Herrler G.
      • Wu N.-H.
      • Nitsche A.
      • Müller M.A.
      • Drosten C.
      • Pöhlmann S.
      SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor.
      ,
      • Sherman E.J.
      • Emmer B.T.
      ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes.
      ), we generated an ACE2 expressing stable HEK293T cell line, herein referred to as eGFP-ACE2/HEK293T cells (Experimental Procedures). The eGFP-ACE2/HEK293T stable cell lines also co-expressed eGFP as a fluorescent marker to facilitate identifying the ACE2 expressing cells (Fig. 2B and Fig. S2) (Experimental Procedures). The eGFP-ACE2/HEK293T cells were transduced with varying dilutions of Spike pseudoviruses (Experimental Procedures). Quantification using FACS analysis showed ∼75%, 55%, 16%, and 4% of cells transduced with mCherry fluorescence correlating with the varying dilution of pseudoviruses, respectively (Fig. S3A and S3B). We characterized the transduction efficiency of the pseudovirus as a function of its multiplicity of infection (MOI). To test the efficacy of nanobodies in blocking viral entry, we choose to perform experiments with pseudovirus MOI that yield >70% transduction efficiency and low cellular cytotoxicity.
      25μM of each nanobody, N1.1 to N1.10, was preincubated with the Spike pseudovirus before infecting eGFP-ACE2/HEK293T cells (Experimental Procedures). Except for N1.2 and N1.3, all the nanobodies showed mCherry fluorescence (i.e., no effect on pseudovirus entry) upon transduction in the eGFP-ACE2/HEK293T cells (Fig. 2C and Fig. S4). Interestingly, the N1.2 nanobody showed maximum efficiency in neutralizing the Spike pseudoviruses compared to the remainder of the nanobodies (Fig. 2C). Therefore, we decided to further characterize the N1.2 nanobody as a potential nanobody against SARS-CoV-2 virus entry.

      Microscopy-based cellular assay to assess N1.2

      In our virus titration assays, we noticed that the FACS-based quantification does not scale according to the mCherry expression (Fig. S3A and S3B). Therefore, we simultaneously correlated the mCherry fluorescence versus virus infection using confocal microscopy-based quantification (Experimental Procedures). In comparison to the FACS data, the confocal microscopy-based measurement showed a sharp decline in mCherry fluorescence, i.e., >80% decrease in mCherry fluorescence when 1/10th of the virus dilution was used for infection (Fig. S3C-E). Therefore, hereafter, we used confocal microscopy-based measurement to assess the neutralizing potential of N1.2 nanobody against Spike pseudovirus. In the pseudovirus assay, we used different concentrations of N1.2 (5μM, 10μM, and 25μM) and could observe a linear reduction in the infectivity of the Spike pseudoviruses in the eGFP-ACE2/HEK293T stable cell lines (Fig. 3, B-C and Fig. S5). To achieve a more potent inhibitory effect with N1.2, we engineered and purified a bivalent nanobody, in which the N1.2 sequence was placed in tandem, separated by a glycine-serine linker (Experimental Procedures) (Fig. S1 and Table S1). The tandem N1.2, termed as (N1.2)2 showed a significant reduction in pseudoviral transduction at 5μM and 10μM concentrations (Fig. 3B and 3C), suggesting a cooperative effect in neutralizing the Spike pseudovirus.
      Figure thumbnail gr3
      Figure 3Assessing the efficacy of nanobody N1.2 using confocal microscopy. A. Maximum intensity Z-projection of confocal images of bald and Spike pseudovirus in the absence and presence of various concentrations of monovalent and bivalent nanobody N1.2 as indicated. The nucleus is shown in blue. The eGFP fluorescence (in green) is a proxy for ACE2 expression in HEK293T cells, and mCherry (in magenta) indicates the extent of virus entry into the eGFP-ACE2/HEK293T cells. Scale bar = 20 microns. B. Mean eGFP fluorescence from individual experiments as indicated, control group represents Spike pseudovirus assay in the absence of nanobody. C. Normalized infectivity quantified from mCherry over eGFP fluorescence for experiments with monovalent and bivalent nanobody N1.2 as indicated. For both B and C, data are shown as scatter plots with average values as column bars, where the mean was calculated from 15 data points from three independent experiments represented as solid circles, squares and triangles respectively. The error bars indicate the standard deviation.
      To confirm if this inhibitory effect of N1.2 and (N1.2)2 is achieved by its direct binding to Spike envelope protein of SARS-CoV-2, we performed control experiments using VSV-G pseudoviruses and bald pseudoviruses (no glycoprotein-envelope control) (Fig. 3A and Fig. S5). These control VSV-G pseudoviruses transduce the stable cells similar to the Spike pseudoviruses in the presence and absence of nanobody N1.2 or (N1.2)2 (Fig. 3A). This indicates that the neutralizing effect of N1.2 and (N1.2)2 is obtained by direct binding of the nanobody to the Spike protein. Therefore, the engineered nanobody N1.2 can be effectively applied for antiviral therapy against COVID-19.

      Efficacy of N1.2 against Omicron Spike variant:

      We also tested the efficacy of the N1.2 against the newly emergent Omicron variant, using the Omicron BA.1 Spike containing pseudoviruses expressing mCherry (Experimental Procedures). First, we confirmed the infectivity of varying concentrations of Omicron Spike pseudovirus against eGFP-ACE2/HEK293T cells and determined an effective MOI (Fig. S3A and 3B). Similar to the hCoV19 (Wuhan/WIV04/2019), the mCherry fluorescence was also scaled with the virus MOI for the Omicron variant Spike pseudovirus in the confocal microscopy-based mCherry quantification (Fig. S3C-E). We further tested the tandem nanobody (N1.2)2 neutralizing effect against the Omicron Spike pseudovirus in GFP-HEK293T (Fig. S6) and eGFP-ACE2/HEK293T (Fig. 4) (Experimental Procedures). The hCoV19 (Wuhan/WIV04/2019) and Omicron Spike pseudovirus were efficiently blocked by 5μM of (N1.2)2 as observed from the confocal images in both cell lines (Fig. 4A and Fig. S6). Quantification of infectivity showed that in the presence of 5μM of (N1.2)2 the infectivity dropped to <10% (Fig. 4B and 4C). Further, it indicates the broad neutralizing ability of the N1.2 nanobody reported here against the current SARS-CoV-2 Omicron variant.
      Figure thumbnail gr4
      Figure 4Comparison of nanobody N1.2 against hCoV19 and Omicron Spike variant. A. Maximum intensity Z-projection of confocal images of hCoV19 and Omicron Spike pseudovirus in the presence of 5μM bivalent nanobody (N1.2)2 as indicated. The nucleus is shown in blue, the eGFP in green, and mCherry in magenta. Scale bar = 20 microns. B & C. Mean eGFP (green) and normalized infectivity quantification of hCoV19 (blue) and Omicron Spike (orange) in the absence and presence of 5μM bivalent nanobody (N1.2)2 as indicated. For both B and C, the data are shown as scatter plots with average values as column bars, N = 18 data points from 3 independent experiments represented as solid circles, squares and triangles respectively. The error bars indicate the standard deviation.

      Discussion

      Since 2020, the SARS-CoV-2 virus has evolved into many subtypes and variants that are still prevalent across the globe (

      Harvey, W. T., Carabelli, A. M., Jackson, B., Gupta, R. K., Thomson, E. C., Harrison, E. M., Ludden, C., Reeve, R., Rambaut, A., COVID-19 Genomics UK (COG-UK) Consortium, Peacock, S. J., and Robertson, D. L. (2021) SARS-CoV-2 variants, spike mutations and immune escape. Nat. Rev. Microbiol. 19, 409–424

      ). Therefore, it is pivotal to identify the broad-spectrum therapeutics that can effectively work against all SARS-CoV-2 subtypes and variants. Equally important is to establish validated pipelines that can expedite identifying new therapeutics against the emerging SARS-CoV-2 variants or new viruses. In this study, we have addressed both needs: first, we have identified a broad spectrum nanobody that neutralizes the original Wuhan (WIV04) and Omicron BA.1 Spike pseudovirus. Secondly, we have achieved the nanobody identification using a peptide as an antigen, unlike the whole Spike or RBD protein of SARS-CoV-2 described earlier (
      • Wang C.
      • Li W.
      • Drabek D.
      • Okba N.M.A.
      • van Haperen R.
      • Osterhaus A.D.M.E.
      • van Kuppeveld F.J.M.
      • Haagmans B.L.
      • Grosveld F.
      • Bosch B.-J.
      A human monoclonal antibody blocking SARS-CoV-2 infection.
      ,
      • Ye M.
      • Fu D.
      • Ren Y.
      • Wang F.
      • Wang D.
      • Zhang F.
      • Xia X.
      • Lv T.
      Treatment with convalescent plasma for COVID-19 patients in Wuhan, China.
      ,
      • Du L.
      • Yang Y.
      • Zhang X.
      Neutralizing antibodies for the prevention and treatment of COVID-19.
      ,
      • Papageorgiou A.C.
      • Mohsin I.
      The SARS-CoV-2 Spike Glycoprotein as a Drug and Vaccine Target: Structural Insights into Its Complexes with ACE2 and Antibodies.
      ,
      • Yu F.
      • Xiang R.
      • Deng X.
      • Wang L.
      • Yu Z.
      • Tian S.
      • Liang R.
      • Li Y.
      • Ying T.
      • Jiang S.
      Receptor-binding domain-specific human neutralizing monoclonal antibodies against SARS-CoV and SARS-CoV-2.
      ). The nanobodies or antibodies obtained by using a whole Spike or RBD bind to different regions of the Spike protein and only a fraction of them were effective in neutralizing the virus (
      • Yu F.
      • Xiang R.
      • Deng X.
      • Wang L.
      • Yu Z.
      • Tian S.
      • Liang R.
      • Li Y.
      • Ying T.
      • Jiang S.
      Receptor-binding domain-specific human neutralizing monoclonal antibodies against SARS-CoV and SARS-CoV-2.
      ), largely because these antibodies target the regions of the Spike protein other than the ones involved in Spike-ACE2 interaction. Peptides as antigens have been widely used for generating potent antibodies targeting the desired epitopes e.g., LDL receptor (
      • Schneider W.J.
      • Slaughter C.J.
      • Goldstein J.L.
      • Anderson R.G.
      • Capra J.D.
      • Brown M.S.
      Use of antipeptide antibodies to demonstrate external orientation of the NH2-terminus of the low density lipoprotein receptor in the plasma membrane of fibroblasts.
      ) ,HA1 of influenza virus (
      • Green N.
      • Alexander H.
      • Olson A.
      • Alexander S.
      • Shinnick T.M.
      • Sutcliffe J.G.
      • Lerner R.A.
      Immunogenic structure of the influenza virus hemagglutinin.
      ), and SV40 virus (
      • Walter G.
      • Scheidtmann K.H.
      • Carbone A.
      • Laudano A.P.
      • Doolittle R.F.
      Antibodies specific for the carboxy- and amino-terminal regions of simian virus 40 large tumor antigen.
      ), including the recent example for SARS-CoV-2 antibodies (
      • Traboulsi H.
      • Khedr M.A.
      • Al-Faiyz Y.S.S.
      • Elgorashe R.
      • Negm A.
      Structure-Based Epitope Design: Toward a Greater Antibody-SARS-CoV-2 RBD Affinity.
      ). These and several other examples suggest that the unstructured peptides can be highly antigenic and potentially yield antibodies that recognize the peptide epitopes in whole protein both in ordered and disordered states. However, peptides and flexible loops from a target protein have seldom been used as antigenic baits for screening display libraries. We previously reported a nanobody against the tubulin post-translation modification using the flexible carboxy-terminal tail peptide (
      • Kesarwani S.
      • Lama P.
      • Chandra A.
      • Reddy P.P.
      • Jijumon A.S.
      • Bodakuntla S.
      • Rao B.M.
      • Janke C.
      • Das R.
      • Sirajuddin M.
      Genetically encoded live-cell sensor for tyrosinated microtubules.
      ). Applying a similar principle, here we show that a nine amino acid peptide from the receptor-binding motif (RBM) of Spike protein can also be employed as an epitope against a nanobody display library. The RBM adopts many conformations depending on the state of the apo Spike protein and in complex with ACE2 (
      • Xu C.
      • Wang Y.
      • Liu C.
      • Zhang C.
      • Han W.
      • Hong X.
      • Wang Y.
      • Hong Q.
      • Wang S.
      • Zhao Q.
      • Wang Y.
      • Yang Y.
      • Chen K.
      • Zheng W.
      • Kong L.
      • Wang F.
      • Zuo Q.
      • Huang Z.
      • Cong Y.
      Conformational dynamics of SARS-CoV-2 trimeric spike glycoprotein in complex with receptor ACE2 revealed by cryo-EM.
      ), and in the absence of ACE2 the RBM appears to be unstructured (
      • Williams J.K.
      • Wang B.
      • Sam A.
      • Hoop C.L.
      • Case D.A.
      • Baum J.
      Molecular dynamics analysis of a flexible loop at the binding interface of the SARS-CoV-2 spike protein receptor-binding domain.
      ). From our experiments the nanobody is able to block the entry of SARS-CoV-2 Spike pseudotyped virus, suggesting that the nanobody N1.2 could potentially recognize the unstructured RBM sequence. This approach of using synthetic peptide as an epitope instead of purified whole protein molecules will certainly accelerate and fine-tune the entire screening process, which will yield nanobodies/antibodies that are efficacious in neutralizing potential targets of viruses in the future.
      The nanobody N1.2 described in this study is effective against both the Spike proteins from the original hCoV19 (Wuhan/WIV04/2019) and the recent Omicron variant. Sequence alignment of the peptide-1 and its surrounding region shows the high similarity between the variants (Fig. S1D), suggesting that epitopes from the conserved RBM region, such as the peptide-1 can yield specific nanobodies or antibodies against the SARS-CoV-2 virus, yet possess broad neutralizing ability against the existing and emerging variants. Almost all the SARS-CoV-2 variants reported to date utilize ACE2 receptor binding for the host cell entry and the RBM region of Spike protein predominantly contributes to this interaction (
      • Sanches P.R.S.
      • Charlie-Silva I.
      • Braz H.L.B.
      • Bittar C.
      • Freitas Calmon M.
      • Rahal P.
      • Cilli E.M.
      Recent advances in SARS-CoV-2 Spike protein and RBD mutations comparison between new variants Alpha (B.1.1.7, United Kingdom), Beta (B.1.351, South Africa), Gamma (P.1, Brazil) and Delta (B.1.617.2, India).
      ,
      • Wu L.
      • Zhou L.
      • Mo M.
      • Liu T.
      • Wu C.
      • Gong C.
      • Lu K.
      • Gong L.
      • Zhu W.
      • Xu Z.
      SARS-CoV-2 Omicron RBD shows weaker binding affinity than the currently dominant Delta variant to human ACE2.
      ). Therefore, we anticipate that the nanobody N1.2 will remain effective in neutralizing the emerging variants as long as the SARS-CoV-2 virus uses ACE2 for gaining entry into the host cells. Additionally, the nanobodies offer advantages in engineering the valency and thereby increasing the efficacy in neutralization against the target molecules. Indeed, when we engineered the nanobody N1.2 into a bivalent version, (N1.2)2, we observed a cooperative effect in neutralizing the pseudovirus even at the highest viral titres. Together, our study offers a platform to identify broad spectrum nanobodies specific against SARS-CoV-2 and its variants, which can be exploited for other therapeutically relevant targets.

      Experimental Procedures

      Peptide epitopes for screening

      The peptide sequences were derived from two different regions of the receptor-binding motif (RBM) of Spike proteins that have been crucial for the interaction of viral Spike protein with the cellular ACE2 receptor. The following peptide sequences from the receptor-binding domain (RBD) of the Spike were synthesized from LifeTein with a biotin tag:
      Peptide-1: [FNCYFPLQS]S-K-Biotin
      Peptide-2: Biotin-[GFQPTNGVGY]

      Sequence Alignment for Covid Variants

      The hCoV19 Spike (Wuhan/WIV04/2019), GISAID (EPI_ISL_402124) construct is a kind gift from Prof. Nevan Krogan, UCSF, USA (

      Gordon, D. E., Jang, G. M., Bouhaddou, M., Xu, J., Obernier, K., White, K. M., O’Meara, M. J., Rezelj, V. V., Guo, J. Z., Swaney, D. L., Tummino, T. A., Hüttenhain, R., Kaake, R. M., Richards, A. L., Tutuncuoglu, B., Foussard, H., Batra, J., Haas, K., Modak, M., Kim, M., Haas, P., Polacco, B. J., Braberg, H., Fabius, J. M., Eckhardt, M., Soucheray, M., Bennett, M. J., Cakir, M., McGregor, M. J., Li, Q., Meyer, B., Roesch, F., Vallet, T., Mac Kain, A., Miorin, L., Moreno, E., Naing, Z. Z. C., Zhou, Y., Peng, S., Shi, Y., Zhang, Z., Shen, W., Kirby, I. T., Melnyk, J. E., Chorba, J. S., Lou, K., Dai, S. A., Barrio-Hernandez, I., Memon, D., Hernandez-Armenta, C., Lyu, J., Mathy, C. J. P., Perica, T., Pilla, K. B., Ganesan, S. J., Saltzberg, D. J., Rakesh, R., Liu, X., Rosenthal, S. B., Calviello, L., Venkataramanan, S., Liboy-Lugo, J., Lin, Y., Huang, X.-P., Liu, Y., Wankowicz, S. A., Bohn, M., Safari, M., Ugur, F. S., Koh, C., Savar, N. S., Tran, Q. D., Shengjuler, D., Fletcher, S. J., O’Neal, M. C., Cai, Y., Chang, J. C. J., Broadhurst, D. J., Klippsten, S., Sharp, P. P., Wenzell, N. A., Kuzuoglu-Ozturk, D., Wang, H.-Y., Trenker, R., Young, J. M., Cavero, D. A., Hiatt, J., Roth, T. L., Rathore, U., Subramanian, A., Noack, J., Hubert, M., Stroud, R. M., Frankel, A. D., Rosenberg, O. S., Verba, K. A., Agard, D. A., Ott, M., Emerman, M., Jura, N., von Zastrow, M., Verdin, E., Ashworth, A., Schwartz, O., d’Enfert, C., Mukherjee, S., Jacobson, M., Malik, H. S., Fujimori, D. G., Ideker, T., Craik, C. S., Floor, S. N., Fraser, J. S., Gross, J. D., Sali, A., Roth, B. L., Ruggero, D., Taunton, J., Kortemme, T., Beltrao, P., Vignuzzi, M., García-Sastre, A., Shokat, K. M., Shoichet, B. K., and Krogan, N. J. (2020) A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature. 583, 459–468

      ). The sequence used for alignment was obtained from NCBI Genbank. The accession number for Alpha (B1.1.7): MW487270.1, Delta (B1.617.2): OK091006.1, and BA.2: OM296922.1. The Omicron MC_0101274 was purchased from Genscript.

      Screening yeast-display nanobody library of nanobodies

      A combinatorial yeast-display library of nanobodies (NbLib) was obtained from Kerafast, Inc. The estimated diversity of the library is around 5*108 unique nanobody clones expressed onto the surface of the yeast cells. The detailed protocol for screening nanobodies against the peptides has been adopted from the method described earlier (
      • McMahon C.
      • Baier A.S.
      • Pascolutti R.
      • Wegrecki M.
      • Zheng S.
      • Ong J.X.
      • Erlandson S.C.
      • Hilger D.
      • Rasmussen S.G.F.
      • Ring A.M.
      • Manglik A.
      • Kruse A.C.
      Yeast surface display platform for rapid discovery of conformationally selective nanobodies.
      ). The frozen vial of NbLib (5-fold excess of library diversity) was grown in 1L Yglc4.5-Trp media (3.8g/L of -Trp drop-out media supplement, 6.7g/L yeast nitrogen base, 10.4g/L sodium citrate, 7.4g/L citric acid monohydrate, 20g/L glucose and 10ml/L PenStrep, pH 4.5) at 30°C for 24-48hr and passaged thrice before the screening. The freshly passaged NbLib (5*109 cells, 10-fold excess of library) was induced in galactose containing media (-Trp +galactose; 3.8g/L of -Trp drop-out media supplement, 6.7g/L yeast nitrogen base, 20g/L galactose and 10ml/L PenStrep, pH 6.0) at 20°C for 72hr to achieve sufficient expression in the library.

      Magnetic selection (MACS)

      Around 5*109 nanobody expressing yeast cells were pelleted to remove media and washed with 10ml selection buffer (20 mM HEPES pH 7.5, 150 mM sodium chloride, 0.1% (w/v) bovine serum albumin, and 5 mM maltose). The cells were resuspended in 4.5ml of selection buffer. First, we performed negative magnetic selection by incubating the above, resuspended cells with 200μl of anti-biotin microbeads (Miltenyi Biotec, catalog no. 130-090-485) and 200μl of streptavidin microbeads (Miltenyi Biotec, catalog no. 130-048-102) at 4°C for 1hr. Post-incubation, the cells were pelleted, resuspended in 5ml selection buffer, and were allowed to pass through (via gravity flow) the LD column (Miltenyi Biotec, catalog no. 130-042-901) placed on Miltenyi MACS magnet (using Midi MACS separator) pre-equilibrated with 5ml selection buffer. The unbound cells were collected and the column was washed with an additional 2ml of the selection buffer to flush out the remaining cells from the column. The cells were pelleted and resuspended in a 3ml selection buffer for positive selection with the peptides.
      First MACS selection: The cells were incubated with a 10μM concentration of peptide-1/peptide-2 at 4°C for 1hr, following which 100μl of anti-biotin microbeads were added and incubated for an additional 20min at 4°C. The cells were pelleted and washed with a 3ml selection buffer. The cells were resuspended in a 3ml selection buffer and passed through the pre-equilibrated (with 5ml selection buffer) LS column (Miltenyi Biotec, catalog no. 130-042-401) placed on the Miltenyi MACS magnet. The LS column was washed with an additional 8ml of the selection buffer to remove unbound cells from the column. The column was removed from the magnet and added 3ml of the selection buffer to the column. Using a plunger, all the bound yeast cells from the column were eluted in 50ml falcon. The cells were pelleted and resuspended in -Trp +glucose media (3.8g/L of -Trp drop-out media supplement, 6.7g/L yeast nitrogen base, 20g/L glucose, and 10ml/L PenStrep, pH 6.0) for growth at 30°C for 48hr.
      Second MACS selection: Took 109 first magnetic sorted cells and induced them in -Trp +galactose media for 72hr. Around 108 freshly induced yeast cells were taken and pelleted. The cells were washed with a 5ml selection buffer and resuspended in a 3ml selection buffer. Added 10μM of the respective peptide and incubated at 4°C for 1hr. To this, added 100μl of streptavidin microbeads and incubated for an additional 20min at 4°C. The cells were pelleted, washed with 3ml selection buffer, and resuspended in 3ml of selection buffer to pass them through the pre-equilibrated LS column placed on the Miltenyi MACS magnet. Washed the column with 8ml additional selection buffer, followed which the column was removed from the magnet and plunged all the bead-bound cells from the column by 3ml selection buffer. The cells were pelleted and resuspended in 5ml -Trp +glucose media and kept for growth at 30°C for 48hr.

      Fluorescent Activated Cell Sorting (FACS)

      Finally, the second MACS sorted culture was induced (around 109 cells) in galactose media at 20°C for 72hr and performed cell sorting experiments to enrich the high-affinity nanobody against the target peptides. Here, we took 107 cells and pelleted them in a microcentrifuge vial. These cells were washed with 1ml selection buffer and resuspended the cells in 100μl selection buffer. The cells were incubated with 100μM of the respective peptide and 1:200 dilution of rabbit anti-HA tag antibody (Sigma; catalog no. Cat # H6908) at 4°C for 1hr. Cells were washed with 1ml selection buffer and resuspended in 100ul of selection buffer for secondary antibody staining. Cells were incubated with 1:200 dilution of goat anti-rabbit Alexa fluor-647 antibody (Invitrogen) and 1:100 dilution of neutravidin fluorescein conjugate (Invitrogen; FITC, catalog no. A2662, used for the first FACS) at 4°C for 30min. Post-incubation cells were washed twice with a 1ml selection buffer to remove unbound reagents. Cells were resuspended in 1ml selection buffer just before sorting them on BD FACS Aria Fusion for double-positive cells, keeping unstained and single stained controls (Central Imaging and Flow Cytometry Facility at the National Centre for Biological Sciences [NCBS]). 0.1–1% of the cells, positive for both the fluorophores (for Neutravidin-FITC and Alexa Fluor 647 fluorophores) which are represented as the P2 population in the Q2 quadrant of the sorting layout. A total of around 8000-10,000 cells were collected and grown in 5 ml fresh -Trp +glucose media at 30°C for 48hr. The freshly grown cells were propagated in larger volumes in the same glucose media (250–500 ml) to make stocks (-Trp +glucose media and 10% DMSO) and further characterize individual clones for their affinity with the respective peptide. After the sorting experiment, the cells were plated onto an agar plate (-Trp +glucose +15 g/liter agar), and 10 single yeast colonies of post-sorted cultures were analyzed on a flow cytometer (Thermo, Attune) for their binding with the respective peptide. Only peptide-1 screening yielded nanobody clones from the library having sufficient binding affinity for peptide-1; therefore, we have only focused on characterizing nanobodies obtained from peptide-1 screening. We have isolated plasmids from these 10 individual yeast clones from peptide-1 screening to identify the protein-coding sequences of these nanobodies for cellular validation.

      Cloning and protein purification

      The nanobody gene was amplified from isolated yeast colonies and cloned between HindIII and XhoI sites in a pET-22b (+) plasmid containing a C-terminal 6x histidine tag.
      The N1.2 nanobody sequence was first cloned with Linker AS-(G4S)3-G in a CMV vector (backbone from Addgene # 12298) using 5’-tccggtggcggaggctccggtggcggaggttccggacaggtgcagctgcaggaaagcgg-3’ and 5’-cacactggatcagttatctatgcggccgctcagtggtggtggtggtggtgctcgaggc -3’ primers. The sequence of N1.2 along with the AS(G4S)3G linker was amplified using 5’-gccagggcacccaggtgaccgtgagcagcgctagcggtggtggaggctccggtggcggaggc-3’ and 5’- cagccggatctcagtggtggtggtggtggtgctcgaggctgctcacggtcacctgggtgccc-3’ primers. This amplified construct of linker-N1.2 was cloned in pet22B amplified vector (5’- cggagcctccaccaccgctagcgctgctcacggtcacctgggtgccc-3’ and 5’- tcgagcaccaccaccaccaccactgagatccggctgctaac-3’) already cloned with N1.2 sequence (between NcoI and XhoI) using Gibson assembly method. The resulting construct contains an amino-terminus pelB sequence, two tandem sequences of N1.2 spaced with AS(G4S)3G linker, and a C-terminus 6X-Histidine tag.
      The nanobodies were purified from Rosetta (DE3) cells in an LB medium by inducing at 0.5 OD with 0.5 mM IPTG at 20 ֠C. After overnight induction, the cells were pelleted down and the protein was extracted by osmotic shock by resuspending in 0.5 M sucrose, 0.2 M Tris, pH 8, 0.5 mM EDTA, followed by water in a 1:3 ratio with 1hr of stirring at 4°C. The lysate was adjusted to contain 150 mM NaCl, 2 mM MgCl2, and 20 mM imidazole and was subjected to centrifugation at 18000 RPM at 4°C to remove cell debris. The supernatant was loaded on 5ml HisTrap HP (GE Healthcare). The column was subsequently washed by high salt buffer (20 mM Tris pH 8, 500 mM NaCl) and low imidazole buffer (20 mM Tris pH 8, 100 mM NaCl, 100 mM imidazole pH 8). The protein was eluted with 20 mM Tris,100 mM NaCl, 400 mM imidazole pH 8. The eluted protein was concentrated in 3KDa cutoff centricon (UFC9003) and buffer exchanged (20 mM Tris pH 8, 100 mM NaCl). The protein was aliquoted, flash-frozen, and stored at -80 °C. (
      • McMahon C.
      • Baier A.S.
      • Pascolutti R.
      • Wegrecki M.
      • Zheng S.
      • Ong J.X.
      • Erlandson S.C.
      • Hilger D.
      • Rasmussen S.G.F.
      • Ring A.M.
      • Manglik A.
      • Kruse A.C.
      Yeast surface display platform for rapid discovery of conformationally selective nanobodies.
      ).

      Cell culture experiments

      Wild type mammalian HEK293T cells and LentiX-293T cells (Takara Bio, catalog no. 632180) were used in this study for pseudotyped Spike virus production and viral transduction assay. Both these cell lines were grown in DMEM (ThermoFisher Scientific; catalog no. 11995065) media supplemented with 10% FBS, 1× PenStrep (Gibco, Thermo Fisher Scientific; catalog no. 15–140-122), and 1× GlutaMAX (Gibco, Catalog number: 35050061) in a humidified 37°C incubator with 5% CO2 supply.

      Spike pseudotyped virus production

      Freshly passaged HEK293T cells were seeded in a 100mm cell culture plate and grown up to 70-80% confluency. The media of the cells were changed to 10 ml complete DMEM without PenStrep before transfection. For viral particle production, 5 μg pHR lentiviral vector cloned with mCherry fluorescent protein, 3.75 μg packaging plasmid psPAX2 (Addgene; #12260), and 2.5 μg envelope plasmid for the expression of Spike glycoprotein (obtained as a kind gift from Prof. Nevan Krogan, UCSF, USA) of SARS-CoV-2 were mixed in 500 μl OptiMEM media and 20 μl PLUS reagent (Invitrogen; LTX transfection reagent, catalog no. L15338100) and kept for incubation at room temperature for 5min. In a separate microcentrifuge vial, 500 μl OptiMEM was taken, and 30 μl Lipofectamine-LTX reagent was added to it. This Lipofectamine-containing solution was added to the plasmid and incubated at room temperature for 20 min. We also generated control lentiviral particles by replacing Spike plasmid with VSV-G envelope protein, pmDG2 (Addgene; #12259) plasmid. The above transfection mix was added to the cells and post 16-18hr; the media was changed to PenStrep containing complete DMEM media. The viral supernatant was collected at 48hr, 72hr, and 96hr post-transfection by replacing 10ml fresh media every time. All the viral supernatant was pooled together and stored at 4°C till 96hr post-transfection. The supernatant was concentrated up to ∼1–3 ml using a 50-KDa Millipore Amicon filter (Merck; UFC905024) at 1,000g and 4°C. The concentrated viral supernatant was mixed with one-third volume of Lenti-X concentrator (Takara Bio; catalog no. 631231) overnight at 4°C and pelleted at 1,500g for 45 min at 4°C. The off-white pellet of the viruses was resuspended in 1–2 ml of complete DMEM media (10% FBS) and stored at −80°C in 100-200 μl aliquots until further use.

      Omicron pseudotyped virus production

      Omicron pseudotyped viruses were produced similarly as described above for Spike pseudoviruses but instead used Omicron envelope plasmid along with packaging plasmid (psPAX2) and lentiviral plasmid (pHR mCherry) in the following ratio: psPAX2 (1.3pmol), pHR mCherry: 1.64pmol, SARS-CoV-2 Omicron Strain S gene (Genscript, Cat # MC_0101274): 0.72pmol.

      Cloning of ACE2 in lentiviral vector (pTRIP vector)

      Human ACE2 was amplified from the mammalian Caco2 cell lines. Caco2 cells were lysed for total RNA purification using the Trizol method. Further, 2 μg of total RNA was set up for cDNA synthesis with Verso cDNA synthesis kit (ThermoFisher Scientific, catalog no. AB1453A) as per the manufacturer’s protocol. The protein-coding sequence of ACE2 was amplified from the cDNA with forward (5’-ggaggagaaccctggacctggatccatgtcaagctcttcctggctcc-3’) and reverse (5’-ctcctgaccctcctcccccgtaaaaggaggtctgaacatc-3’) primers using Q5 polymerase PCR reaction (NEB, catalog no. M0492L). This amplified construct of ACE2 was cloned into a pTRIP chicken β-actin (CAG) vector (Gentili et al., 2015). This construct contains amino-terminus eGFP followed by self-cleaving 2A peptide sequence followed by ACE2 and carboxy-termini SNAP-tag and FLAG tags (eGFP-ACE2/HEK293T)

      Generation of stable HEK293T cell line for over-expression of ACE2

      The lentiviral pTRIP vector cloned with eGFP-ACE2/HEK293T under CMV enhancer and chicken β-actin promoter (CAG promoter) flanked with 5 and 3′ long terminal repeat (LTR) sequences (
      • Gentili M.
      • Kowal J.
      • Tkach M.
      • Satoh T.
      • Lahaye X.
      • Conrad C.
      • Boyron M.
      • Lombard B.
      • Durand S.
      • Kroemer G.
      • Loew D.
      • Dalod M.
      • Théry C.
      • Manel N.
      Transmission of innate immune signaling by packaging of cGAMP in viral particles.
      ) were used to produce lentiviral particles as per the method described before (
      • Kesarwani S.
      • Lama P.
      • Chandra A.
      • Reddy P.P.
      • Jijumon A.S.
      • Bodakuntla S.
      • Rao B.M.
      • Janke C.
      • Das R.
      • Sirajuddin M.
      Genetically encoded live-cell sensor for tyrosinated microtubules.
      ). Briefly, 70-80% confluent HEK293T cells were transfected with 5 μg lentiviral construct of eGFP-ACE2-SNAP-FLAG, 3.75 μg psPAX2 (Addgene; #12260), and 2.5 μg pmDG2 (Addgene; #12259) plasmids using Lipofectamine-LTX reagent. The lentiviruses collected at 48hr, 72, and 96hr were concentrated and pelleted using a lenti-X concentrator. The white pellet of lentiviruses was resuspended in 2ml of complete DMEM media and 1ml of this virus was used to transduce HEK293T cells for stable expression of ACE2 in these cells. We could only achieve the transduction efficiency of 60-70% and therefore, we performed fluorescent activated cell sorting (FACS) experiments to enrich the eGFP expressing (a proxy for ACE2 expression) HEK293T cells in the culture. In our sorted culture, >90% of cells were found to be eGFP positive or expressing eGFP-ACE2.

      Immunofluorescence assay for ACE2 expression

      The stable HEK293T cells were seeded in ibidi glass-bottom dishes (catalog no. 81218) precoated with Poly-D-Lysine and grown to 70% confluency. The cells were washed with 1xBRB80 (80 mM Pipes, 1 mM MgCl2, and 1 mM EGTA, pH 6.8) buffer twice and fixed using 100% ice-cold Methanol for 10min at -20°C. Post fixation cells were washed twice with 1xBRB80 buffer and permeabilized in the same buffer having 0.1% Triton-X-100 for 10min at room temperature. Cells were blocked with 5% BSA made in 1xBRB80 + 0.1% Triton-X-100 for 1hr at room temperature. Cells were incubated with 1:500 dilution of mouse anti-FLAG monoclonal antibody (Merck, catalog no. F3165) overnight at 4°C. Further, cells were washed thrice for 5min using a blocking buffer, followed by secondary goat anti-mouse Alexa Fluor-647 antibody (Invitrogen; 1:1000 dilution) incubation in the same blocking buffer at room temperature for 2hr. Cells were stained for nucleus using DAPI (1 μg/ml) for 10 min followed by five washes with 1xBRB80 for 5min. Cells were imaged on an H-TIRF microscope using 405nm, 488nm, and 640nm laser with appropriate filter sets.

      Immunoblotting assay for ACE2 expression

      The HEK293T cells were seeded in a 35mm dish grown to 70% confluency. The cells were transfected with 1μg of eGFP-ACE2-SNAP-FLAG with Jet Prime reagent for 24hrs and 48hrs. Cells were lysed with RIPA buffer and subjected to 12% SDS-PAGE. The wet transfer was performed on methanol activated PVDF membrane for 75mins at 100V at 4°C. The blots were probed with 1:5000 anti-Flag antibody (Sigma, F3165) overnight at 4°C followed by 1:10000 anti-mouse secondary at room temperature for 1hr. The blots were developed by chemiluminescence on iBright1500 (Invitrogen) by Pierce ECL substrate (ThermoFisher Scientific; Catalog no. 32106).

      ELISA assay

      The surface of the 96 well plates was passivated with BSA-biotin (Thermo Fisher Scientific; catalog no. 29130, 1 mg/ml, 5 min), followed by a 1×PBS wash. The surface was coated with 0.5 mg/ml Streptavidin (Thermo Fisher Scientific; catalog no. 43–4302) for 5 min and washed twice with 1xPBS (8 g/liter NaCl, 0.2 g/liter KCl, 1.44 g/liter Na2HPO4, 0.24 g/liter KH2PO4, pH 7.4). The surface was immobilized with a 200 μM biotinylated peptide-1/peptide-2 sequence for 30min on ice. The well surface was blocked with 5% BSA containing 1xPBS for 1hr on ice. All the nanobodies (containing carboxy-termini 6x-His-tag) screened for peptide-1 were diluted in blocking buffer at 10 μM concentration and were incubated with the immobilized peptides for 1hr on ice. The surface of the well was washed twice with blocking buffer and incubated with HRP-conjugated rabbit anti-6xHis tag antibody (Abcam; catalog no. AB1187), 1: 10,000 dilution at 4°C overnight. The wells were washed thrice with the blocking buffer and incubated with 100μl of 1:10 diluted (diluted in distilled water) TMB substrate solution (3,3',5,5'-tetramethylbenzidine; ThermoFisher Scientific, catalog no. N301). Once the color starts to develop, stop the reaction using 0.2 mM sulfuric acid. The color will turn yellow upon sulfuric acid addition, which was measured for absorbance at 450nm using a spectrophotometer keeping appropriate controls (wells not having any immobilized peptides). The intensity of the yellow color represents the binding of nanobodies with the respective peptide. The relative absorbance (A450) values of individual nanobodies plotted in the graph represent A450 with peptide subtracted from A450 without peptide.

      Pseudoviral transduction assay

      The GFP/HEK293T cells or eGFP-ACE2/HEK293T cells were grown up to 60-70% confluency in complete media before viral transduction. In a separate vial mCherry pseudoviruses/ lentiviruses were incubated with the respective purified nanobody at room temperature for 5 minutes. The cells were transduced with the above viral mix along with 2 μg/ml Polybrene (Merck; catalog no. TR-1003-G) overnight (12-15hr), keeping appropriate positive and negative controls. Post viral incubation, cells were grown in complete media for 48hr and then processed for flow cytometric analysis and confocal imaging.
      In this assay, the viral titer was used in a concentration such that to obtain more than 70% transduction efficiency in the eGFP-ACE2/HEK293T or eGFP/HEK293T cell line. We have used 10μl of Spike pseudoviruses and 4μl Omicron pseudoviruses for flow cytometry and microscopy experiments. For flow cytometric analysis, cells were resuspended in 1xPBS and were subjected to Attune NxT Acoustic Focusing Cytometer to measure red (mCherry) and green (eGFP-ACE2/HEK293T) fluorescence using YL2 (620/15 nm) and BL1 (530/30 nm) filters. Confocal imaging was performed to quantitate the mCherry expression in the stable HEK293T cells after pseudoviral transduction in the presence and absence of the N1.2 and (N1.2)2 nanobodies.
      Quantification of percentage transduction of cells with pseudovirus (Spike and Omicron) was done on BD LSRFortessa using 488 and 561 lasers with 530/30 (505LP) and 610/20 (600LP), respectively.

      Imaging and Statistical Analysis

      All the images were acquired on an inverted confocal microscope (Olympus FV3000) equipped with six solid state laser lines (405, 445, 488, 514, 561, and 640 nm) and a 20x oil objective. For the acquisition and quantification of viral transduction in the pseudoviral assay, high sensitivity spectral detectors were used marking a specific region of interest in the 2048*2048 pixel frame. For all the sets of images acquired for quantification laser power, voltage, and gain settings were kept constant. Images were analyzed on Fiji software to calculate mean fluorescence intensity (MFI) for eGFP (ACE2 expression) and mCherry (viral transduction) channels from the z-projected stacks. All the experiments were performed in triplicate sets on at least two different days. Normalized infectivity represents the mean mCherry intensity of a particular z-projected stack over the GFP intensity of the same stacks. Representative images are the z-projected stacks of the respective condition. eGFP-ACE2/HEK293T immunostained with FLAG antibody was imaged at 60x oil objective of FV3000 confocal microscope (Fig. 2B) and 100x oil objective of H-TIRF microscope (Fig. S2A) using 405nm, 488nm and 647nm laser lines for DAPI, eGFP, and Alexa fluor-647 fluorophores.

      Data Availability

      All the data generated during the study are included in the main text and supporting information.

      Competing interests

      The commercial usage and application related to the N1.2 nanobody sequence are patent protected.

      Acknowledgments

      The authors acknowledge the Central Imaging and Flow Facility (CIFF) at the Bangalore Life Science Cluster, India. M.S acknowledges funding support from inStem core grants from the Department of Biotechnology, India, DBT/Wellcome Trust India Alliance Intermediate Fellowship (IA/I/14/2/501533), EMBO Young Investigator Programme award, CEFIPRA (5703-1) from the Department of Science and Technology, SERB-EMR grant (CRG/2019/003246) and DBT-BIRAC (BT/PR40389/COT/142/6/2020) grant. A.C is supported by the DBT/Wellcome Trust India Alliance Early-Career Fellowship (IA/E/15/1/502339). R.G and D.D are supported by a CSIR Fellowship. N.M supported by inStem graduate program.

      References

        • Tang D.
        • Comish P.
        • Kang R.
        The hallmarks of COVID-19 disease.
        PLOS Pathog. 2020; 16e1008536
        • Xu Z.
        • Liu K.
        • Gao G.F.
        Omicron variant of SARS-CoV-2 imposes a new challenge for the global public health.
        Biosaf. Health. 2022; https://doi.org/10.1016/j.bsheal.2022.01.002
        • Cobey S.
        • Larremore D.B.
        • Grad Y.H.
        • Lipsitch M.
        Concerns about SARS-CoV-2 evolution should not hold back efforts to expand vaccination.
        Nat. Rev. Immunol. 2021; 21: 330-335
        • He Y.
        • Lu H.
        • Siddiqui P.
        • Zhou Y.
        • Jiang S.
        (2005) Receptor-binding domain of severe acute respiratory syndrome coronavirus spike protein contains multiple conformation-dependent epitopes that induce highly potent neutralizing antibodies.
        J. Immunol. Baltim. Md. 1950; 174: 4908-4915
        • Lan J.
        • Ge J.
        • Yu J.
        • Shan S.
        • Zhou H.
        • Fan S.
        • Zhang Q.
        • Shi X.
        • Wang Q.
        • Zhang L.
        • Wang X.
        Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor.
        Nature. 2020; https://doi.org/10.1038/s41586-020-2180-5
        • Walls A.C.
        • Park Y.-J.
        • Tortorici M.A.
        • Wall A.
        • McGuire A.T.
        • Veesler D.
        Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein.
        Cell. 2020; 181 (e6): 281-292
        • Shang J.
        • Wan Y.
        • Luo C.
        • Ye G.
        • Geng Q.
        • Auerbach A.
        • Li F.
        Cell entry mechanisms of SARS-CoV-2.
        Proc. Natl. Acad. Sci. U. S. A. 2020; 117: 11727-11734
        • Custódio T.F.
        • Das H.
        • Sheward D.J.
        • Hanke L.
        • Pazicky S.
        • Pieprzyk J.
        • Sorgenfrei M.
        • Schroer M.A.
        • Gruzinov A.Y.
        • Jeffries C.M.
        • Graewert M.A.
        • Svergun D.I.
        • Dobrev N.
        • Remans K.
        • Seeger M.A.
        • McInerney G.M.
        • Murrell B.
        • Hällberg B.M.
        • Löw C.
        Selection, biophysical and structural analysis of synthetic nanobodies that effectively neutralize SARS-CoV-2.
        Nat. Commun. 2020; 11: 5588
        • Hanke L.
        • Vidakovics Perez L.
        • Sheward D.J.
        • Das H.
        • Schulte T.
        • Moliner-Morro A.
        • Corcoran M.
        • Achour A.
        • Karlsson Hedestam G.B.
        • Hällberg B.M.
        • Murrell B.
        • McInerney G.M.
        An alpaca nanobody neutralizes SARS-CoV-2 by blocking receptor interaction.
        Nat. Commun. 2020; 11: 4420
      1. Huo, J., Bas, A. L., Ruza, R., Duyvesteyn, H. M. E., Mikolajek, H., Malinauskas, T., Tan, T. K., Rijal, P., Dumoux, M., Ward, P., Ren, J., Zhou, D., Harrison, P., Radeke, J., Zhao, Y., Gilbert-Jaramillo, J., Knight, M., Carrique, L., Shah, P. N. M., James, W., Townsend, A., Stuart, D., Owens, R., and Naismith, J. (2020) Structural characterisation of a nanobody derived from a naïve library that neutralises SARS-CoV-2. 10.21203/rs.3.rs-32948/v1

        • Mast F.D.
        • Fridy P.C.
        • Ketaren N.E.
        • Wang J.
        • Jacobs E.Y.
        • Olivier J.P.
        • Sanyal T.
        • Molloy K.R.
        • Schmidt F.
        • Rutkowska M.
        • Weisblum Y.
        • Rich L.M.
        • Vanderwall E.R.
        • Dambrauskas N.
        • Vigdorovich V.
        • Keegan S.
        • Jiler J.B.
        • Stein M.E.
        • Olinares P.D.B.
        • Herlands L.
        • Hatziioannou T.
        • Sather D.N.
        • Debley J.S.
        • FenyӦ D.
        • Sali A.
        • Bieniasz P.D.
        • Aitchison J.D.
        • Chait B.T.
        • Rout M.P.
        Highly synergistic combinations of nanobodies that target SARS-CoV-2 and are resistant to escape.
        eLife. 2021; 10e73027
        • Shi R.
        • Shan C.
        • Duan X.
        • Chen Z.
        • Liu P.
        • Song J.
        • Song T.
        • Bi X.
        • Han C.
        • Wu L.
        • Gao G.
        • Hu X.
        • Zhang Y.
        • Tong Z.
        • Huang W.
        • Liu W.J.
        • Wu G.
        • Zhang B.
        • Wang L.
        • Qi J.
        • Feng H.
        • Wang F.-S.
        • Wang Q.
        • Gao G.F.
        • Yuan Z.
        • Yan J.
        A human neutralizing antibody targets the receptor-binding site of SARS-CoV-2.
        Nature. 2020; 584: 120-124
        • Wang C.
        • Li W.
        • Drabek D.
        • Okba N.M.A.
        • van Haperen R.
        • Osterhaus A.D.M.E.
        • van Kuppeveld F.J.M.
        • Haagmans B.L.
        • Grosveld F.
        • Bosch B.-J.
        A human monoclonal antibody blocking SARS-CoV-2 infection.
        Nat. Commun. 2020; 11: 2251
        • Wrapp D.
        • De Vlieger D.
        • Corbett K.S.
        • Torres G.M.
        • Wang N.
        • Van Breedam W.
        • Roose K.
        • van Schie L.
        • Hoffmann M.
        • Pöhlmann S.
        • Graham B.S.
        • Callewaert N.
        • Schepens B.
        • Saelens X.
        • McLellan J.S.
        • VIB-CMB COVID-19 Response Team
        Structural Basis for Potent Neutralization of Betacoronaviruses by Single-Domain Camelid Antibodies.
        Cell. 2020; 181: 1436-1441
        • Xiang Y.
        • Nambulli S.
        • Xiao Z.
        • Liu H.
        • Sang Z.
        • Duprex W.P.
        • Schneidman-Duhovny D.
        • Zhang C.
        • Shi Y.
        Versatile and multivalent nanobodies efficiently neutralize SARS-CoV-2.
        Science. 2020; 370: 1479-1484
        • Ye M.
        • Fu D.
        • Ren Y.
        • Wang F.
        • Wang D.
        • Zhang F.
        • Xia X.
        • Lv T.
        Treatment with convalescent plasma for COVID-19 patients in Wuhan, China.
        J. Med. Virol. 2020; 92: 1890-1901
        • Schoof M.
        • Faust B.
        • Saunders R.A.
        • Sangwan S.
        • Rezelj V.
        • Hoppe N.
        • Boone M.
        • Billesbølle C.B.
        • Puchades C.
        • Azumaya C.M.
        • Kratochvil H.T.
        • Zimanyi M.
        • Deshpande I.
        • Liang J.
        • Dickinson S.
        • Nguyen H.C.
        • Chio C.M.
        • Merz G.E.
        • Thompson M.C.
        • Diwanji D.
        • Schaefer K.
        • Anand A.A.
        • Dobzinski N.
        • Zha B.S.
        • Simoneau C.R.
        • Leon K.
        • White K.M.
        • Chio U.S.
        • Gupta M.
        • Jin M.
        • Li F.
        • Liu Y.
        • Zhang K.
        • Bulkley D.
        • Sun M.
        • Smith A.M.
        • Rizo A.N.
        • Moss F.
        • Brilot A.F.
        • Pourmal S.
        • Trenker R.
        • Pospiech T.
        • Gupta S.
        • Barsi-Rhyne B.
        • Belyy V.
        • Barile-Hill A.W.
        • Nock S.
        • Liu Y.
        • Krogan N.J.
        • Ralston C.Y.
        • Swaney D.L.
        • García-Sastre A.
        • Ott M.
        • Vignuzzi M.
        • Walter P.
        • Manglik A.
        • QCRG Structural Biology Consortium
        An ultrapotent synthetic nanobody neutralizes SARS-CoV-2 by stabilizing inactive Spike.
        Science. 2020; 370: 1473-1479
        • B Z.
        • S L.
        • T T.
        • W H.
        • Y D.
        • L C.
        • Q C.
        • L Z.
        • Q Z.
        • X Z.
        • Y Z.
        • S Z.
        Treatment With Convalescent Plasma for Critically Ill Patients With Severe Acute Respiratory Syndrome Coronavirus 2 Infection.
        Chest. 2020; https://doi.org/10.1016/j.chest.2020.03.039
        • Cao Y.
        • Su B.
        • Guo X.
        • Sun W.
        • Deng Y.
        • Bao L.
        • Zhu Q.
        • Zhang X.
        • Zheng Y.
        • Geng C.
        • Chai X.
        • He R.
        • Li X.
        • Lv Q.
        • Zhu H.
        • Deng W.
        • Xu Y.
        • Wang Y.
        • Qiao L.
        • Tan Y.
        • Song L.
        • Wang G.
        • Du X.
        • Gao N.
        • Liu J.
        • Xiao J.
        • Su X.-D.
        • Du Z.
        • Feng Y.
        • Qin C.
        • Qin C.
        • Jin R.
        • Xie X.S.
        Potent Neutralizing Antibodies against SARS-CoV-2 Identified by High-Throughput Single-Cell Sequencing of Convalescent Patients’ B Cells.
        Cell. 2020; 182 (e16): 73-84
        • Minenkova O.
        • Santapaola D.
        • Milazzo F.M.
        • Anastasi A.M.
        • Battistuzzi G.
        • Chiapparino C.
        • Rosi A.
        • Gritti G.
        • Borleri G.
        • Rambaldi A.
        • Dental C.
        • Viollet C.
        • Pagano B.
        • Salvini L.
        • Marra E.
        • Luberto L.
        • Rossi A.
        • Riccio A.
        • Pich E.M.
        • Santoro M.G.
        • Santis R.D.
        Human inhalable antibody fragments neutralizing SARS-CoV-2 variants for COVID-19 therapy.
        Mol. Ther. 2022; https://doi.org/10.1016/j.ymthe.2022.02.013
        • Shen C.
        • Wang Z.
        • Zhao F.
        • Yang Y.
        • Li J.
        • Yuan J.
        • Wang F.
        • Li D.
        • Yang M.
        • Xing L.
        • Wei J.
        • Xiao H.
        • Yang Y.
        • Qu J.
        • Qing L.
        • Chen L.
        • Xu Z.
        • Peng L.
        • Li Y.
        • Zheng H.
        • Chen F.
        • Huang K.
        • Jiang Y.
        • Liu D.
        • Zhang Z.
        • Liu Y.
        • Liu L.
        Treatment of 5 Critically Ill Patients With COVID-19 With Convalescent Plasma.
        JAMA. 2020; 323: 1582-1589
        • Wu X.
        • Cheng L.
        • Fu M.
        • Huang B.
        • Zhu L.
        • Xu S.
        • Shi H.
        • Zhang D.
        • Yuan H.
        • Nawaz W.
        • Yang P.
        • Hu Q.
        • Liu Y.
        • Wu Z.
        A potent bispecific nanobody protects hACE2 mice against SARS-CoV-2 infection via intranasal administration.
        Cell Rep. 2021; 37109869
        • Ye G.
        • Gallant J.
        • Zheng J.
        • Massey C.
        • Shi K.
        • Tai W.
        • Odle A.
        • Vickers M.
        • Shang J.
        • Wan Y.
        • Du L.
        • Aihara H.
        • Perlman S.
        • LeBeau A.
        • Li F.
        The development of Nanosota-1 as anti-SARS-CoV-2 nanobody drug candidates.
        eLife. 2021; 10e64815
        • Muyldermans S.
        Nanobodies: natural single-domain antibodies.
        Annu. Rev. Biochem. 2013; 82: 775-797
        • Bannas P.
        • Hambach J.
        • Koch-Nolte F.
        Nanobodies and Nanobody-Based Human Heavy Chain Antibodies As Antitumor Therapeutics.
        Front. Immunol. 2017; 8: 1603
        • Vincke C.
        • Loris R.
        • Saerens D.
        • Martinez-Rodriguez S.
        • Muyldermans S.
        • Conrath K.
        General strategy to humanize a camelid single-domain antibody and identification of a universal humanized nanobody scaffold.
        J. Biol. Chem. 2009; 284: 3273-3284
        • Ghorbani M.
        • Brooks B.R.
        • Klauda J.B.
        Exploring dynamics and network analysis of spike glycoprotein of SARS-COV-2.
        Biophys. J. 2021; 120: 2902-2913
        • McMahon C.
        • Baier A.S.
        • Pascolutti R.
        • Wegrecki M.
        • Zheng S.
        • Ong J.X.
        • Erlandson S.C.
        • Hilger D.
        • Rasmussen S.G.F.
        • Ring A.M.
        • Manglik A.
        • Kruse A.C.
        Yeast surface display platform for rapid discovery of conformationally selective nanobodies.
        Nat. Struct. Mol. Biol. 2018; 25: 289-296
        • Chen M.
        • Zhang X.-E.
        Construction and applications of SARS-CoV-2 pseudoviruses: a mini review.
        Int. J. Biol. Sci. 2021; 17: 1574-1580
        • Hoffmann M.
        • Kleine-Weber H.
        • Schroeder S.
        • Krüger N.
        • Herrler T.
        • Erichsen S.
        • Schiergens T.S.
        • Herrler G.
        • Wu N.-H.
        • Nitsche A.
        • Müller M.A.
        • Drosten C.
        • Pöhlmann S.
        SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor.
        Cell. 2020; 181 (e8): 271-280
        • Sherman E.J.
        • Emmer B.T.
        ACE2 protein expression within isogenic cell lines is heterogeneous and associated with distinct transcriptomes.
        bioRxiv. 2021; https://doi.org/10.1101/2021.03.26.437218
      2. Harvey, W. T., Carabelli, A. M., Jackson, B., Gupta, R. K., Thomson, E. C., Harrison, E. M., Ludden, C., Reeve, R., Rambaut, A., COVID-19 Genomics UK (COG-UK) Consortium, Peacock, S. J., and Robertson, D. L. (2021) SARS-CoV-2 variants, spike mutations and immune escape. Nat. Rev. Microbiol. 19, 409–424

        • Du L.
        • Yang Y.
        • Zhang X.
        Neutralizing antibodies for the prevention and treatment of COVID-19.
        Cell. Mol. Immunol. 2021; 18: 2293-2306
        • Papageorgiou A.C.
        • Mohsin I.
        The SARS-CoV-2 Spike Glycoprotein as a Drug and Vaccine Target: Structural Insights into Its Complexes with ACE2 and Antibodies.
        Cells. 2020; 9: E2343
        • Yu F.
        • Xiang R.
        • Deng X.
        • Wang L.
        • Yu Z.
        • Tian S.
        • Liang R.
        • Li Y.
        • Ying T.
        • Jiang S.
        Receptor-binding domain-specific human neutralizing monoclonal antibodies against SARS-CoV and SARS-CoV-2.
        Signal Transduct. Target. Ther. 2020; 5: 212
        • Schneider W.J.
        • Slaughter C.J.
        • Goldstein J.L.
        • Anderson R.G.
        • Capra J.D.
        • Brown M.S.
        Use of antipeptide antibodies to demonstrate external orientation of the NH2-terminus of the low density lipoprotein receptor in the plasma membrane of fibroblasts.
        J. Cell Biol. 1983; 97: 1635-1640
        • Green N.
        • Alexander H.
        • Olson A.
        • Alexander S.
        • Shinnick T.M.
        • Sutcliffe J.G.
        • Lerner R.A.
        Immunogenic structure of the influenza virus hemagglutinin.
        Cell. 1982; 28: 477-487
        • Walter G.
        • Scheidtmann K.H.
        • Carbone A.
        • Laudano A.P.
        • Doolittle R.F.
        Antibodies specific for the carboxy- and amino-terminal regions of simian virus 40 large tumor antigen.
        Proc. Natl. Acad. Sci. 1980; 77: 5197-5200
        • Traboulsi H.
        • Khedr M.A.
        • Al-Faiyz Y.S.S.
        • Elgorashe R.
        • Negm A.
        Structure-Based Epitope Design: Toward a Greater Antibody-SARS-CoV-2 RBD Affinity.
        ACS Omega. 2021; 6: 31469-31476
        • Kesarwani S.
        • Lama P.
        • Chandra A.
        • Reddy P.P.
        • Jijumon A.S.
        • Bodakuntla S.
        • Rao B.M.
        • Janke C.
        • Das R.
        • Sirajuddin M.
        Genetically encoded live-cell sensor for tyrosinated microtubules.
        J. Cell Biol. 2020; 219e201912107
        • Xu C.
        • Wang Y.
        • Liu C.
        • Zhang C.
        • Han W.
        • Hong X.
        • Wang Y.
        • Hong Q.
        • Wang S.
        • Zhao Q.
        • Wang Y.
        • Yang Y.
        • Chen K.
        • Zheng W.
        • Kong L.
        • Wang F.
        • Zuo Q.
        • Huang Z.
        • Cong Y.
        Conformational dynamics of SARS-CoV-2 trimeric spike glycoprotein in complex with receptor ACE2 revealed by cryo-EM.
        Sci. Adv. 2021; 7: eabe5575
        • Williams J.K.
        • Wang B.
        • Sam A.
        • Hoop C.L.
        • Case D.A.
        • Baum J.
        Molecular dynamics analysis of a flexible loop at the binding interface of the SARS-CoV-2 spike protein receptor-binding domain.
        Proteins Struct. Funct. Bioinforma. 2022; 90: 1044-1053
        • Sanches P.R.S.
        • Charlie-Silva I.
        • Braz H.L.B.
        • Bittar C.
        • Freitas Calmon M.
        • Rahal P.
        • Cilli E.M.
        Recent advances in SARS-CoV-2 Spike protein and RBD mutations comparison between new variants Alpha (B.1.1.7, United Kingdom), Beta (B.1.351, South Africa), Gamma (P.1, Brazil) and Delta (B.1.617.2, India).
        J. Virus Erad. 2021; 7100054
        • Wu L.
        • Zhou L.
        • Mo M.
        • Liu T.
        • Wu C.
        • Gong C.
        • Lu K.
        • Gong L.
        • Zhu W.
        • Xu Z.
        SARS-CoV-2 Omicron RBD shows weaker binding affinity than the currently dominant Delta variant to human ACE2.
        Signal Transduct. Target. Ther. 2022; 7: 8
      3. Gordon, D. E., Jang, G. M., Bouhaddou, M., Xu, J., Obernier, K., White, K. M., O’Meara, M. J., Rezelj, V. V., Guo, J. Z., Swaney, D. L., Tummino, T. A., Hüttenhain, R., Kaake, R. M., Richards, A. L., Tutuncuoglu, B., Foussard, H., Batra, J., Haas, K., Modak, M., Kim, M., Haas, P., Polacco, B. J., Braberg, H., Fabius, J. M., Eckhardt, M., Soucheray, M., Bennett, M. J., Cakir, M., McGregor, M. J., Li, Q., Meyer, B., Roesch, F., Vallet, T., Mac Kain, A., Miorin, L., Moreno, E., Naing, Z. Z. C., Zhou, Y., Peng, S., Shi, Y., Zhang, Z., Shen, W., Kirby, I. T., Melnyk, J. E., Chorba, J. S., Lou, K., Dai, S. A., Barrio-Hernandez, I., Memon, D., Hernandez-Armenta, C., Lyu, J., Mathy, C. J. P., Perica, T., Pilla, K. B., Ganesan, S. J., Saltzberg, D. J., Rakesh, R., Liu, X., Rosenthal, S. B., Calviello, L., Venkataramanan, S., Liboy-Lugo, J., Lin, Y., Huang, X.-P., Liu, Y., Wankowicz, S. A., Bohn, M., Safari, M., Ugur, F. S., Koh, C., Savar, N. S., Tran, Q. D., Shengjuler, D., Fletcher, S. J., O’Neal, M. C., Cai, Y., Chang, J. C. J., Broadhurst, D. J., Klippsten, S., Sharp, P. P., Wenzell, N. A., Kuzuoglu-Ozturk, D., Wang, H.-Y., Trenker, R., Young, J. M., Cavero, D. A., Hiatt, J., Roth, T. L., Rathore, U., Subramanian, A., Noack, J., Hubert, M., Stroud, R. M., Frankel, A. D., Rosenberg, O. S., Verba, K. A., Agard, D. A., Ott, M., Emerman, M., Jura, N., von Zastrow, M., Verdin, E., Ashworth, A., Schwartz, O., d’Enfert, C., Mukherjee, S., Jacobson, M., Malik, H. S., Fujimori, D. G., Ideker, T., Craik, C. S., Floor, S. N., Fraser, J. S., Gross, J. D., Sali, A., Roth, B. L., Ruggero, D., Taunton, J., Kortemme, T., Beltrao, P., Vignuzzi, M., García-Sastre, A., Shokat, K. M., Shoichet, B. K., and Krogan, N. J. (2020) A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature. 583, 459–468

        • Gentili M.
        • Kowal J.
        • Tkach M.
        • Satoh T.
        • Lahaye X.
        • Conrad C.
        • Boyron M.
        • Lombard B.
        • Durand S.
        • Kroemer G.
        • Loew D.
        • Dalod M.
        • Théry C.
        • Manel N.
        Transmission of innate immune signaling by packaging of cGAMP in viral particles.
        Science. 2015; 349: 1232-1236