Advertisement

Ubiquitin-specific peptidase 14 maintains estrogen receptor α stability via its deubiquitination activity in endometrial cancer

  • Yingjie Su
    Affiliations
    Department of Cell Biology, Key laboratory of Cell Biology, Ministry of Public Health, and Key laboratory of Medical Cell Biology, Ministry of Education, School of Life Sciences, China Medical University, Shenyang City, Liaoning Province 110122, China

    Department of Gynecology, the First Hospital of China Medical University, Shenyang City, Liaoning Province 110001, P.R. China
    Search for articles by this author
  • Kai Zeng
    Affiliations
    Department of Cell Biology, Key laboratory of Cell Biology, Ministry of Public Health, and Key laboratory of Medical Cell Biology, Ministry of Education, School of Life Sciences, China Medical University, Shenyang City, Liaoning Province 110122, China
    Search for articles by this author
  • Shuchang Liu
    Affiliations
    Department of Gynecology, the Fourth Affiliated Hospital of China Medical University, Shenyang City, Liaoning Province 110032, China
    Search for articles by this author
  • Yi Wu
    Affiliations
    Department of Cell Biology, Key laboratory of Cell Biology, Ministry of Public Health, and Key laboratory of Medical Cell Biology, Ministry of Education, School of Life Sciences, China Medical University, Shenyang City, Liaoning Province 110122, China

    Department of Pathogenic Biology, Shenyang Medical College, Shenyang, Liaoning, 110034, China
    Search for articles by this author
  • Chunyu Wang
    Affiliations
    Department of Cell Biology, Key laboratory of Cell Biology, Ministry of Public Health, and Key laboratory of Medical Cell Biology, Ministry of Education, School of Life Sciences, China Medical University, Shenyang City, Liaoning Province 110122, China
    Search for articles by this author
  • Shengli Wang
    Affiliations
    Department of Cell Biology, Key laboratory of Cell Biology, Ministry of Public Health, and Key laboratory of Medical Cell Biology, Ministry of Education, School of Life Sciences, China Medical University, Shenyang City, Liaoning Province 110122, China
    Search for articles by this author
  • Lin Lin
    Affiliations
    Department of Cell Biology, Key laboratory of Cell Biology, Ministry of Public Health, and Key laboratory of Medical Cell Biology, Ministry of Education, School of Life Sciences, China Medical University, Shenyang City, Liaoning Province 110122, China
    Search for articles by this author
  • Renlong Zou
    Affiliations
    Department of Cell Biology, Key laboratory of Cell Biology, Ministry of Public Health, and Key laboratory of Medical Cell Biology, Ministry of Education, School of Life Sciences, China Medical University, Shenyang City, Liaoning Province 110122, China
    Search for articles by this author
  • Ge Sun
    Affiliations
    Department of Cell Biology, Key laboratory of Cell Biology, Ministry of Public Health, and Key laboratory of Medical Cell Biology, Ministry of Education, School of Life Sciences, China Medical University, Shenyang City, Liaoning Province 110122, China
    Search for articles by this author
  • Ruina Luan
    Affiliations
    Department of Cell Biology, Key laboratory of Cell Biology, Ministry of Public Health, and Key laboratory of Medical Cell Biology, Ministry of Education, School of Life Sciences, China Medical University, Shenyang City, Liaoning Province 110122, China
    Search for articles by this author
  • Baosheng Zhou
    Affiliations
    Department of Cell Biology, Key laboratory of Cell Biology, Ministry of Public Health, and Key laboratory of Medical Cell Biology, Ministry of Education, School of Life Sciences, China Medical University, Shenyang City, Liaoning Province 110122, China
    Search for articles by this author
  • Yu Bai
    Affiliations
    Department of Cell Biology, Key laboratory of Cell Biology, Ministry of Public Health, and Key laboratory of Medical Cell Biology, Ministry of Education, School of Life Sciences, China Medical University, Shenyang City, Liaoning Province 110122, China
    Search for articles by this author
  • Jumin Niu
    Affiliations
    Department of Obstetrics and Gynecology, Shenyang Women's and Children's Hospital, Shenyang, Liaoning, 110011, China
    Search for articles by this author
  • Yi Zhang
    Correspondence
    Corresponding authors: Yi Zhang. Department of Gynecology, the First Hospital of China Medical University, Shenyang City, Liaoning Province 110001, P.R. China,
    Affiliations
    Department of Gynecology, the First Hospital of China Medical University, Shenyang City, Liaoning Province 110001, P.R. China
    Search for articles by this author
  • Yue Zhao
    Correspondence
    Corresponding authors: Yue Zhao. Department of Cell Biology, Key laboratory of Cell Biology, Ministry of Public Health, and Key laboratory of Medical Cell Biology, Ministry of Education, School of Life Sciences, China Medical University, No.77 Puhe Road, Shenyang North New Area, Shenyang City, Liaoning Province, P.R. China. 110122,
    Affiliations
    Department of Cell Biology, Key laboratory of Cell Biology, Ministry of Public Health, and Key laboratory of Medical Cell Biology, Ministry of Education, School of Life Sciences, China Medical University, Shenyang City, Liaoning Province 110122, China
    Search for articles by this author
Open AccessPublished:November 21, 2022DOI:https://doi.org/10.1016/j.jbc.2022.102734

      Abstract

      Endometrial cancer (EC) is one of the common gynecological malignancies of which the incidence has been rising for decades. It is considered that continuously unopposed estrogen exposure is the main risk factor for EC initiation. Thus, exploring the modulation of estrogen/estrogen receptor (ERα) signaling pathway in EC would be helpful to well understand the mechanism of EC development and find the potential target for EC therapy. Ubiquitin-specific peptidase 14 (USP14), a member of the proteasome-associated deubiquitinating enzyme family, plays a crucial role in a series of tumors. However, the function of USP14 in EC is still elusive. Here, our results have demonstrated that USP14 is highly expressed in EC tissues compared with that in normal endometrial tissues, and higher expression of USP14 is positively correalted with poor prognosis. Moreover, USP14 maintains ERα stability through its deubiquitination activity. Our results further demonstrate that USP14 depletion decreases the expression of ERα-regulated genes in EC-derived cell lines. Moreover, knockdown of USP14 or USP14-specific inhibitor treatment significantly suppresses cell growth and migration in EC cell lines or in mice. We further provide the evidence to show that the effect of USP14 on EC cell growth, if not all, at least is partially related to ERα pathway. Our study provides new sights for USP14 to be a potential therapeutic target for the treatment of EC, especially for EC patients with fertility preservation needs.

      Key words

      Abbreviations:

      EC (endometrial cancer), USP14 (Ubiquitin-specific peptidase 14), ERα (estrogen receptor α), BCa (breast cancer), AR (androgen receptor), MDM2 (murine double minute 2), ERE (estrogen-response element), TCGA (the Cancer Genome Atlas), CHX (cycloheximide), Co-IP (Co-immunoprecipitation), qPCR (quantitative PCR), DUBs (deubiquitinating enzymes)

      Introduction

      Endometrial carcinoma (EC) is one of the gynecological malignancies, with an increasing incidence in the world (
      • Ferlay J.
      • Soerjomataram I.
      • Dikshit R.
      • Eser S.
      • Mathers C.
      • Rebelo M.
      • et al.
      Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012.
      ,
      • Bray F.
      • Ferlay J.
      • Soerjomataram I.
      • Siegel R.L.
      • Torre L.A.
      • Jemal A.
      Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries.
      ). It has been reported that EC patients who are at advanced stage or suffer from recurrence have poor prognosis (
      • Arend R.C.
      • Jones B.A.
      • Martinez A.
      • Goodfellow P.
      Endometrial cancer: Molecular markers and management of advanced stage disease.
      ). According to the updated statistics, there are about 66,570 new cases and 12,940 deaths in the United States in 2021 (
      • Siegel R.L.
      • Miller K.D.
      • Fuchs H.E.
      • Jemal A.
      Cancer Statistics, 2021.
      ), indicating an increase in the morbidity and mortality of EC. Importantly, due to the younger age of EC onset, the treatment strategies with fertility preservation are critical and challenging. Therefore, it is necessary to understand the molecular mechanism of EC development and explore more effective and therapeutic target for EC treatment.
      In consideration of hormonal dependence in EC, it is divided into 2 types, including type I hormone-dependent and type II hormone-independent (
      • Bokhman J.V.
      Two pathogenetic types of endometrial carcinoma.
      ). Type I accounts for 80% of the EC cases, with the feature of positive estrogen receptor α (ERα) expression (
      • Carlson M.J.
      • Thiel K.W.
      • Leslie K.K.
      Past, present, and future of hormonal therapy in recurrent endometrial cancer.
      ). It is generally known that long-term unopposed estrogen (E2) exposure is the main risk factor for type I EC, indicating that E2/ERα signaling pathway plays a significant role in EC development and progression. Previous studies have shown that ERα, as a transcription factor, is involved in the pathogenic process in breast cancer (BCa) (
      • Tecalco-Cruz A.C.
      • Ramirez-Jarquin J.O.
      • Cruz-Ramos E.
      Estrogen Receptor Alpha and its Ubiquitination in Breast Cancer Cells.
      ). A number of co-regulators involved in the modulation of ERα activity promote tumorigenesis and contribute to endocrine therapy resistance in BCa (
      • Xia X.
      • Liao Y.
      • Huang C.
      • Liu Y.
      • He J.
      • Shao Z.
      • et al.
      Deubiquitination and stabilization of estrogen receptor alpha by ubiquitin-specific protease 7 promotes breast tumorigenesis.
      ,
      • Tang J.
      • Luo Y.
      • Tian Z.
      • Liao X.
      • Cui Q.
      • Yang Q.
      • et al.
      TRIM11 promotes breast cancer cell proliferation by stabilizing estrogen receptor alpha.
      ,
      • Chen X.S.
      • Wang K.S.
      • Guo W.
      • Li L.Y.
      • Yu P.
      • Sun X.Y.
      • et al.
      UCH-L1-mediated Down-regulation of Estrogen Receptor alpha Contributes to Insensitivity to Endocrine Therapy for Breast Cancer.
      ). However, the regulation of ERα signaling pathway and its underlying biological function in EC progression are still largely unknown.
      Ubiquitin-specific protease 14 (USP14), as one of the proteasome-associated deubiquitinase, exerts important roles in several carcinomas (
      • Yu F.
      • Liu J.B.
      • Wu Z.J.
      • Xie W.T.
      • Zhong X.J.
      • Hou L.K.
      • et al.
      Tumor suppressive microRNA-124a inhibits stemness and enhances gefitinib sensitivity of non-small cell lung cancer cells by targeting ubiquitin-specific protease 14.
      ,
      • Sharma A.
      • Almasan A.
      USP14 Regulates DNA Damage Response and Is a Target for Radiosensitization in Non-Small Cell Lung Cancer.
      ). It has been reported that USP14 appears to have quite different functions in modulating intracellular proteolytic degradation involving in both maintenance of protein stability and protein degradation (
      • Liu B.
      • Jiang S.
      • Li M.
      • Xiong X.
      • Zhu M.
      • Li D.
      • et al.
      Proteome-wide analysis of USP14 substrates revealed its role in hepatosteatosis via stabilization of FASN.
      ,
      • Kim H.T.
      • Goldberg A.L.
      UBL domain of Usp14 and other proteins stimulates proteasome activities and protein degradation in cells.
      ). Ubp6, a yeast homologue of USP14, participates in delaying protein degradation to lead to protein accumulation (
      • Hanna J.
      • Hathaway N.A.
      • Tone Y.
      • Crosas B.
      • Elsasser S.
      • Kirkpatrick D.S.
      • et al.
      Deubiquitinating enzyme Ubp6 functions noncatalytically to delay proteasomal degradation.
      ). Studies have been shown that USP14 stabilizes androgen receptor (AR) protein through its deubiquitination activity. USP14 can also promote cell growth and inhibit cell apoptosis in AR-positive ERα-negative breast cancer (
      • Liao Y.
      • Xia X.
      • Liu N.
      • Cai J.
      • Guo Z.
      • Li Y.
      • et al.
      Growth arrest and apoptosis induction in androgen receptor-positive human breast cancer cells by inhibition of USP14-mediated androgen receptor deubiquitination.
      ). USP14 interacts with murine double minute 2 (MDM2) and stabilizes MDM2, leading to tumor progression in cervical cancer (
      • Xu L.
      • Wang J.
      • Yuan X.
      • Yang S.
      • Xu X.
      • Li K.
      • et al.
      IU1 suppresses proliferation of cervical cancer cells through MDM2 degradation.
      ). USP14 regulates cisplatin-resistance in ovarian cancer through stabilizing BCL6 protein (
      • Shen J.
      • Hong L.
      • Chen L.
      Ubiquitin-specific protease 14 regulates ovarian cancer cisplatin-resistance by stabilizing BCL6 oncoprotein.
      ). However, the functional analysis of USP14 in EC is still largely elusive.
      In this study, we have demonstrated that USP14 is highly expressed in EC clinical samples compared with that in non-carcinomas endometrial tissues. The higher expression level of USP14 is positively correlated with the poor prognosis of EC. Our results also provide the evidence that USP14 is involved in maintenance of ERα stability through its deubiquitinating activity. USP14 deubiqitinates ERα at lysine 48 (K48)-linked ubiquitination. In addition, depletion of USP14 down-regulates ERα-induced gene transcription. Knockdown of USP14 decreases the recruitment of ERα to estrogen-response element (ERE) of c-Myc, which is one of the putative ERα target genes. Furthermore, USP14 depletion or USP14-specific inhibitor attenuates cell growth and migration in EC-derived cell lines or in mice. Taken together, our study may provide a potential therapeutic target for the treatment of EC, especially for EC patients with fertility preservation needs.

      Results

      USP14 is highly expressed in EC tissues, and the higher expression of USP14 is positively correlated with the poor prognosis of EC patients

      Previous studies have shown that USP14 is highly expressed in a variety of malignancies and plays a critical role in tumors progression (
      • Wang D.
      • Ma H.
      • Zhao Y.
      • Zhao J.
      Ubiquitin-specific protease 14 is a new therapeutic target for the treatment of diseases.
      ). However, the expression level and functions of USP14 in EC remain poorly defined. To this end, we then analyzed the expression of USP14 in EC tissues and normal endometrial tissues using UALCAN. The results demonstrated that USP14 has a higher expression in EC tissues (Fig. 1A) (
      • Chandrashekar D.S.
      • Bashel B.
      • Balasubramanya S.A.H.
      • Creighton C.J.
      • Ponce-Rodriguez I.
      • Chakravarthi B.
      • et al.
      UALCAN: A Portal for Facilitating Tumor Subgroup Gene Expression and Survival Analyses.
      ). We then analyzed the expression level of USP14 at different clinical stages and histological subtypes. The results indicated that there was no obviously difference among the stages and various histological subtypes (Fig. S1A, B). To further investigate whether there was a correlation between USP14 and the clinical outcomes of the patients, we performed an analysis through Kaplan-Meier plotter based on the Cancer Genome Atlas (TCGA) (
      • Nagy A.
      • Munkacsy G.
      • Gyorffy B.
      Pancancer survival analysis of cancer hallmark genes.
      ), the results showed that the aberrant expression of USP14 was negatively associated with the overall survival and the relapse free survival (Fig. 1B, C).
      Figure thumbnail gr1
      Figure 1USP14 is overexpressed in EC and negatively associated with the prognosis. (A) USP14 was overexpressed in EC patients according to the UALCAN database. (B-C) Kaplan-Meier analysis was used to detect the overall survival and relapse free survival for the EC patients based on the Cancer Genome Atlas. (D-E) Immunohistochemical assay was used to detect the USP14 expression in normal tissues and cancerous tissues. Magnification: 10x/20x: Scale bars: 100 μm/50 μm (F-G) Expression level of USP14 was detected by western blot and was quantited with Image J in the normal tissues (n=19) and cancerous tissues (n=31). (H-I) Western blot was used to determine the expression of USP14 and ERα in 20 EC tissues. Pearson correlation test showed the statistical significance between UISP14 and ERα.
      We then detected the expression of USP14 in the collected 31 normal tissues and 99 EC tissues from the First Hospital of China Medical University. Hereafter, western blot was conducted to further determine the expression of USP14 in 19 non-carcinomas tissues and 31 endometrial cancer tissues. The results from immunohistochemistry assay or western blotting showed that the expression level of USP14 was significantly higher in the EC tissues compared with that in the non-carcinomous tissues (Fig. 1D-G). Having established that ERα plays a significant role in EC progression, we then examined the corresponding expression of USP14 and ERα in 20 EC samples. Our results showed that the expression of USP14 was positively correlated with that of ERα in EC samples (Fig. 1H, I).

      USP14 pariticates in maintenance of ERα stability

      Having known the correlation between the expression of USP14 and ERα, we then turned to investigate the underlying mechanism between them. We measured the expression of ERα following ectopic expression of USP14, which indicated USP14 could affect ERα at protein level in a dose-dependent manner (Fig. 2A and S2A). Then, in the EC cell lines with USP14 depletion or treated with indicated IU1, a specific inhibitor of USP14 (
      • Lee B.H.
      • Lee M.J.
      • Park S.
      • Oh D.C.
      • Elsasser S.
      • Chen P.C.
      • et al.
      Enhancement of proteasome activity by a small-molecule inhibitor of USP14.
      ), a significant decrease in ERα expression was noted at the protein level, but not at the mRNA level (Fig. 2B-D and S2B, C). These results suggested that USP14 affected ERα by inhibiting its degradation, but not regulating its transcription. To further verify this opinion, we treated the cells with protein synthesis inhibitor, cycloheximide (CHX) to determine the influence of USP14 on ERα in HEK293 and HEC-1A cells. The results demonstrated that USP14 overexpression retarded ERα degradation, while inhibition of USP14 accelerated ERα degradation (Fig. 2E-J). In addition, in the presence of the proteasome inhibitor MG132, the increase of ERα by USP14 overexpression was reversed in both Ishikawa and HEC-1A cell lines (Fig. 2K, L and S2D). Taken together, these data suggested that USP14 might be involved in maintenance of ERα stability via inhibiting the proteasome pathway in EC cell lines.
      Figure thumbnail gr2
      Figure 2USP14 participates in maintenance of ERα stability. (A) Overexpression of USP14 increase the ERα protein level in a dose-dependent manner in both Ishikawa and HEC-1A cell lines. (B) Depletion of USP14 in EC cell lines can decrease the ERα protein level. (C) Protein lysate was collected with indicated concentration of USP14 specific inhibitor (IU1) for 48h in both EC cell lines. (D) Total RNA of Ishikawa cells transfected with siCtrl or siUSP14 were used to analyze the ESR1 mRNA level. (E-F) HEK293 was transfected with ERα and USP14. The cell was treated with 50mg/ml cycloheximide (CHX) for 0h, 4h, 8h and then the ERα protein level was detected with western blot. (G-H) HEC-1A cells was transfected with USP14 and treated with 50mg/ml cycloheximide (CHX) for indicated time points. The remaining ERα protein level was quantited by Image J. (I-J) HEC-1A cells were transfected with siCtrl or siUSP14 and treated with CHX as HEK293. The ERα protein level was calculated as described above. (K-L) Depletion of USP14 decreased ERα protein level in both Ishikawa cells and HEC-1A cells. The cell lysate was treated with MG132 (5 μM) for 6h before collected. P<0.05, ∗∗P<0.01, ∗∗∗P<0.001, ∗∗∗∗P<0.0001.

      USP14 interacts with ERα and deubiquitinates ERα with K48-lingkage

      We further turn to determine whether USP14 interactes with ERα. The expression plasmids of FLAG-tagged-USP14 and HA-tagged-ERα were then transfected to perform Co-immunoprecipitation (Co-IP) experiments in COS7 cell lines. The results demonstrated that USP14 interacted with ERα with or without E2 treatment (Fig. 3A). To further confirm these results, we performed Co-IP in EC cell lines (Ishikawa and HEC-1A cell lines), the results suggested an endogenous interaction between USP14 and ERα in EC-derived cell lines (Fig. 3B, C). Due to the deubiquitination activity of USP14, we wonder whether USP14 can participates in influence of ERα ubiquitination. Immunoprecipitation (IP)-based ubiquitination assays were then performed as indicated. The results demonstrated that the ectopic expression of USP14 apparently reduced the level of ERα ubiquitination in EC cell lines (Fig. 3D). Moreover, USP14 depletion or USP14 inhibitor treatment significantly increased ERα ubiquitination (Fig. 3E, F). Thus, these results indicated that USP14 participated in deubiquitination of ERα to maintain stabilization of ERα protein.
      Figure thumbnail gr3
      Figure 3USP14 interacts with ERα and deubiquitinates ERα via K48-lingkage. (A-C) USP14 interacted with ERα. Co-IP assay was performed in COS7 cells and EC cell lines with indicated antibodies. (D-E) Immunoprecipitation (IP)-based ubiquitination assays was conducted in both EC cell lines. Overexpression or depletion of USP14 could decrease or increase ERα ubiquitination level in EC cell lines. (F) HEC-1A cells were treated with indicated IU1 for 48h. Immunoprecipitation (IP)-based ubiquitination assays was performed with ERα antibodies. (G-H) HEC-1A cells were transfected with expression plasmid encoding FLAG-USP14 and ERα together with HA-tagged ubiquitin mutants, including K0 (lysineless), K48 (only K48-linked Ub) and K63 (only K63-linked Ub) as indicated. The cells were treated with MG132 (5 μM) before collected. The cell lystate were immunoprecipitated with anti-ERα and immunoblotted with anti-HA.
      It has been well established that different polyubiquitination types of protein exert various functions, of which lysine 48 (K48)- and lysine 63 (K63)-linked poly-Ub chain represents a signal for proteasomal degradation (
      • Kravtsova-Ivantsiv Y.
      • Sommer T.
      • Ciechanover A.
      The lysine48-based polyubiquitin chain proteasomal signal: not a single child anymore.
      ,
      • Kim H.T.
      • Kim K.P.
      • Lledias F.
      • Kisselev A.F.
      • Scaglione K.M.
      • Skowyra D.
      • et al.
      Certain pairs of ubiquitin-conjugating enzymes (E2s) and ubiquitin-protein ligases (E3s) synthesize nondegradable forked ubiquitin chains containing all possible isopeptide linkages.
      ). We turned to determine which type of poly-Ub chain on ERα was affected by USP14. Our results showed that ectopic expression of USP14 decreased K48-linked ubiquitination of ERα, but not K63-linked in HEC-1A cells (Fig. 3G). Furthermore, different dose of the ectopic expression of USP14 showed a significant reduction of K48-linked ubiquitination of ERα in a dose-dependent manner in HEC-1A cells (Fig. 3H). Above all, our results suggested that USP14 was involved in ERα deubiquitination with K48-linkege to maintain the stability of ERα.

      USP14 promotes the transcription level of ERα target genes

      Having established that USP14 may increase the accumulation of ERα, we then turn to study whether the downstream genes of ERα were modulated by USP14 in EC-derived cells. Quantitative PCR (qPCR) was performed to detect the mRNA expression level of ERα target genes. We examined the mRNA level of MYC, E2F1, UBe2C in EC-derived cell lines with knockdown of USP14. Our results showed that depletion of USP14 carrying three different sequences of siUPS14 (siUSP14 #1, #2, #3) obviously inhibited the expression of ERα-regulated genes in the presence of E2 in Ishikawa cells (Fig. 4A-C). To further confirm this result, the Ishikawa cells were transfected with USP14 expression plasmid with cotreatment of 10nM fulvestrant (anti-estrogen) as indicated. The result showed that the up-regulation of ectopic USP14 expression on ERα-regulated genes was significantly reduced by fulvestrant treatment (Fig. 4D). We further investigated the protein expression levels of ERα downstream genes by western blot, and our data demonstrated that depletion of USP14 decreased the protein expression levels of ERα-regulated genes. While ectopic expression of USP14 increased these protein expression of ERα-regulated genes as indicated in EC-derived cells (Fig. 4E, F). We then tried to detect whether USP14 had any impact on the recruitment of ERα on the promoter region of ERα target gene. With JASPAR database, we tried to search the putative estrogen response element (ERE), which contains the sequence of AGGGGAAAGAGGACCTG on the promoter region of ERα-regulated gene, MYC as indicated (Fig. 4G). ChIP assay was then performed to determine the recruitment of ERα at the ERE in the Ishikawa cells carrying shRNA against USP14 (shUSP14). The depletion of USP14 was shown to decrease the recruitment of ERα on the ERE region of MYC gene (Fig. 4H). Taken together, USP14 was involved in promotion of the transcription of ERα-regulated genes, and USP14 also increased the recruitment of ERα on the promoter region of ERα-regulated gene.
      Figure thumbnail gr4
      Figure 4USP14 promotes the expression of ERα target genes, and enhances the recruitment of ERα to ERE region of ERα target gene. (A-C) The effect of USP14 on the mRNA level of endogenous ERα target genes with three independent siRNAs against USP14 (siUSP14#1, 2, 3). (D) The effect of ectopic USP14 expression on mRNA level of endogenous ERα target genes with the treatment of fulvestrant and E2 as indicated. (E-F) The effect of USP14 on the protein level of endogenous ERα target genes with 10nM E2. (G) The schematic diagram of the ERα binding site on the promoter region of MYC. (H) The recruitment of ERα on ERE with the depletion of USP14 in Ishikawa cells.

      USP14 promotes the cell proliferation and migration in EC-derived cell lines

      To further examine the function of USP14 in EC-derived cells, we constructed the stable knocked down of USP14 in Ishikawa and HEC-1A carrying shRNA against USP14 (shUSP14). The efficiency of USP14 knockdown by shUSP14 in EC-derived cell lines was detected with western blot (Fig. 5A). Then colony formation assay was performed in Ishikawa cells, which showed that the depletion of USP14 could inhibit the ability of colony formation. Moreover, Ishikawa cells and HEC-1A cells were treated with different concentration of USP14-specific inhibitor, IU1 (0μM, 25μM, 50μM). The results showed that IU1 inhibited the colony formation in a dose-dependent manner in EC-derived cell lines (Fig. 5B and S3A, B). We then further determined whether USP14 influences the cell cycle, and the flow cytometry analysis was performed in Ishikawa cells with indicated IU1. The results indicated that IU1 could induce G0/G1 arrest (Fig. 5C, D). To study the effect of USP14 on the cell proliferation in EC-derived cells, MTS and colony formation assay were performed in the absence or presence of E2 in Ishikawa cells and HEC-1A cells. Our data demonstrated that USP14 obviously promoted cell proliferation in EC-derived cell lines (Fig. 5E-G and S3C, D). In addition, to determine whether ERα is required for the biological function of USP14 on cell growth in EC-derived cells, overexpression plasmid of ERα was transfected into the Ishikawa cells carrying shUSP14. Our results demonstrated that ectopic expression of ERα could partially reverse the growth inhibition caused by shUSP14 (Fig. 5H). Taken together, USP14 is involved in promotion of cell growth in EC-derived cells at least partially via E2/ERα.
      Figure thumbnail gr5
      Figure 5USP14 promotes the cell proliferation, partly depending on ERα. (A) The confirmation of USP14 knockdown efficiency in EC cell lines. (B) The effect of USP14 on cell growth by colony formation assay. The concentration of E2 was 10 nM. (C-D) Flow cytometry was performed on Ishikawa cells treated with indicated IU1 for cell cycle analysis. (E-F) Depletion of USP14 could inhibit cell proliferation under the stimulation of 10 nM E2 in EC cell lines. (G) Depletion of USP14 could inhibit cell colony formation under the stimulation of E2 in EC cell lines. (H) The inhibition function of USP14 depletion could be partly reversed by ectopic ERα overexpression.
      To investigate the effect of USP14 on cell migration, the wound healing assay was performed in Ishikawa cells carrying shUSP14 or IU1 treatment. The results showed that inhibition of USP14 significantly decreased the cell migration in Ishikawa cells (Fig. 6A, B). Furthermore, with different concentrations of IU1 treatment, the results from the transwell assay showed that the migration ability of Ishikawa cells was inhibited by IU1 treatment in a dose-dependent manner (Fig. 6C, D). Subsequently, the transwell assay was further performed with Ishikawa cells under the treatment of E2. The results demonstrated that USP14 depletion inhibited cell migration, and conversely, ectopic expression of USP14 promoted cell migration in the presence of E2 (Fig. 6E-H).
      Figure thumbnail gr6
      Figure 6USP14 facilities the cell migration via ERα. (A-B) USP14 depletion or USP14 inhibition (IU1) could inhibit cell migration by wound healing assay in Ishikawa cells. Scale bars, 100 μm. (C-D) Transwell assay was performed with IU1 as indicated. IU1 could inhibit cell migration in a dose-dependent manner. Scale bars, 100 μm. (E-F) Overexpression of USP14 (oe-USP14) promoted cell migration in the presence of E2. Three independent experiments was statistically analyzed as indicated. Scale bars, 100 μm. (G-H) Depletion of USP14 could suppress cell migration in the presence of E2. Three independent experiments was statistically analyzed as indicated. Scale bars, 100 μm. P<0.05, ∗∗P<0.01, ∗∗∗P<0.001, ∗∗∗∗P<0.0001.

      Depletion of USP14 or USP14-specific inhibitor suppresses cell growth in EC-derived cell lines and in mice

      To further examine the biological function of USP14 in cell growth in vivo, we conducted subcutaneous xenograft tumor experiments in NOD/SCID mice to detect the effect of USP14 depletion on cell growth in EC-derived cells. The Ishikawa cells (1*107 cells/mouse) transfected with shCtrl or shUSP14 were respectively injected into the left and right flank of the 4-week-old female mice. The results demonstrated that the combination of shUSP14 and IU1 appeared to show the best antitumor activity. The tumors with shUSP14 or treated with IU1 alone were similar in size (Fig. 7A). The tumor weight and volume significantly declined under the treatment of shUSP14 or IU1 alone and declined more obviously under the combined treatment of shUSP14 and IU1 (Fig. 7B, C). IHC experiments were then performed to detect the expression level of USP14 in xenograft tumor derived from Ishikawa cells (Fig. 7D). In addition, western blot was performed to examine the protein level of USP14, ERα, and c-Myc in the above xenograft tumor. The results further demonstrated that USP14 depletion significantly decreased ERα and c-Myc expression (Fig. 7E). Taken together, our results suggest that knockdown of USP14 or IU1 treatment inhibits EC-derived cell growth in mice.
      Figure thumbnail gr7
      Figure 7Depletion or inhibition of USP14 can suppress cell growth in mice. (A) Photos were shown to representative the tumor-bearing as indicated. Scale bars, 1 cm. (B-C) Tumor weight and volume of different groups were shown as indicated. (D) Immunohistochemical assay was performed to detect the expression of USP14 in the xenograft tumor tissues. Scale bars, 50 μm. (E) Protein level of USP14 in every xenograft tumor tissue was detected by western blot. (F) Schematic diagram was presented to demonstrate the interaction between USP14 and ERα and the function of USP14 in the development of EC.

      Discussion

      Endometrial Cancer (EC) is one of the common carcinomas in women’s reproductive system. The treatment of hysterectomy is efficacious in patients at an early stage. However, the intervention strategy for the relapse patients and the advanced stage patients is limited. Although EC belongs to one of the hormone-dependent tumors, the endocrine therapy in EC is not effective compared with that in BCa. It has been considered that E2/ERα signaling pathway is essential for the development of EC. However, the biological function of ERα co-regulator in EC is still elusive. In this study, our results have demonstrated that USP14 is involved in maintenance of ERα stabilization to contribute to the progression of EC, providing a potential therapeutic target for EC patients, especially for fertility preservation EC patients (Fig. 7F).
      It has been reported that USP14 is highly related to cancer occurrence and progression in various kinds of carcinomas. As one of the proteasome-associated deubiquitinating enzymes (DUBs), USP14 has a dual function in protein degradation and proteasome function. USP14 is elevated in prostate cancer and androgen receptor (AR)-positive breast cancer, and the expression of USP14 is positively correlated with that of AR. Downregulation of USP14 may suppress cell proliferation, migration, and promote cell apoptosis via stabilizing AR in prostate cancer or AR-positive breast cancer (
      • Liao Y.
      • Xia X.
      • Liu N.
      • Cai J.
      • Guo Z.
      • Li Y.
      • et al.
      Growth arrest and apoptosis induction in androgen receptor-positive human breast cancer cells by inhibition of USP14-mediated androgen receptor deubiquitination.
      ,
      • Liao Y.
      • Liu N.
      • Hua X.
      • Cai J.
      • Xia X.
      • Wang X.
      • et al.
      Proteasome-associated deubiquitinase ubiquitin-specific protease 14 regulates prostate cancer proliferation by deubiquitinating and stabilizing androgen receptor.
      ). In addition, USP14 enhances Wnt/β-catenin signaling pathway via stabilizing β-catenin to promote tumor development in lung cancer and hepatocellular cancer (
      • Huang G.
      • Li L.
      • Zhou W.
      USP14 activation promotes tumor progression in hepatocellular carcinoma.
      ,
      • Wu N.
      • Liu C.
      • Bai C.
      • Han Y.P.
      • Cho W.C.
      • Li Q.
      Over-expression of deubiquitinating enzyme USP14 in lung adenocarcinoma promotes proliferation through the accumulation of beta-catenin.
      ). However, the biological function and underlying molecular mechanism of USP14 in EC progression is still unclear. Previous study has indicated that USP14 is a predictor of recurrence for EC patients and pharmacological inhibition of USP14 with VXL1570 may increase the EC patients’ chemotherapeutic response rate (
      • Vogel R.I.
      • Pulver T.
      • Heilmann W.
      • Mooneyham A.
      • Mullany S.
      • Zhao X.
      • et al.
      USP14 is a predictor of recurrence in endometrial cancer and a molecular target for endometrial cancer treatment.
      ). Similar biological function results are found in our study. Our results suggest that USP14 is up-regulated in EC clinical samples, and the highly expression of USP14 is positively correlated with the poor prognosis of EC patients. Different from previous studies, our study focuses more on providing insight into the relationship between USP14 and E2/ERα, which is a main risk factor for the initiation of EC. Our study have demonstrated that USP14 is involved in maintenance of ERα through ERα deubiquitination. Moreover, we also provide the evidence that USP14 depletion or USP14 inhibitor treatment abrogates cell growth in EC-derived cell lines and in mice, suggesting that the interaction between USP14 and ERα may promote EC progression.
      Unopposed estrogen exposure is one of the main risk factors for Type I EC. It has been putatively considered that almost 80% of Type I EC is ERα positive, indicating that modulation of E2/ERα signaling pathway would be essential for the development of ERα related cancers, such as breast cancer, and EC. It is well known that ERα protein stability is strictly controlled by ubiquitin proteasome system. Previously studies have established that E3 ligases, such as RNF8, TRIM11 may modulate ERα mono-ubiquitination to stabilize ERα and then promote breast cancer progression (
      • Tang J.
      • Luo Y.
      • Tian Z.
      • Liao X.
      • Cui Q.
      • Yang Q.
      • et al.
      TRIM11 promotes breast cancer cell proliferation by stabilizing estrogen receptor alpha.
      ,
      • Wang S.
      • Luo H.
      • Wang C.
      • Sun H.
      • Sun G.
      • Sun N.
      • et al.
      RNF8 identified as a co-activator of estrogen receptor alpha promotes cell growth in breast cancer.
      ). USP22 has been identified to deubiquitinate ERα with both K48-linkage and K63-linkage to enhance the stability of ERα, thereby promoting cell growth and endocrine resistance in breast cancer (
      • Wang S.
      • Zhong X.
      • Wang C.
      • Luo H.
      • Lin L.
      • Sun H.
      • et al.
      USP22 positively modulates ERalpha action via its deubiquitinase activity in breast cancer.
      ). As a deubiqutinase, UCH-L1 suppresses ERα transcription through the deubiquitinase-mediated stability of EGFR, which is a co-repressor of ERα (
      • Chen X.S.
      • Wang K.S.
      • Guo W.
      • Li L.Y.
      • Yu P.
      • Sun X.Y.
      • et al.
      UCH-L1-mediated Down-regulation of Estrogen Receptor alpha Contributes to Insensitivity to Endocrine Therapy for Breast Cancer.
      ). Thus, understanding well the modulation of ERα in ERα-related tumors would provide the potential therapeutic strategy for tumor treatment. In this study, our results have shown that USP14 associates with ERα to maintain the stability of ERα via its deubiquitination activity in EC. USP14 depletion or USP14 inhibitor treatment enhances ERα poly-ubiquitination level with K48-linkage, but not K63-linkage. Our data suggest that USP14 involved in the enhancement of ERα stability in EC may be a new strategy for developing the endocrine therapeutic target for EC treatment.
      Our previous study has demonstrated that Ash2L acting as a co-activator of ERα is associated with MLL1/WDR5 complex to enhance ERα action and participate in the promotion of EC progression (
      • Zeng K.
      • Wu Y.
      • Wang C.
      • Wang S.
      • Sun H.
      • Zou R.
      • et al.
      ASH2L is involved in promotion of endometrial cancer progression via upregulation of PAX2 transcription.
      ). In addition, it has been reported that mutations in the ligand binding domain of ERα may cause continuous activation of the ERα signaling pathway in EC (
      • Backes F.J.
      • Walker C.J.
      • Goodfellow P.J.
      • Hade E.M.
      • Agarwal G.
      • Mutch D.
      • et al.
      Estrogen receptor-alpha as a predictive biomarker in endometrioid endometrial cancer.
      ). Our data have demonstrated that USP14 enhances the recruitment of ERα on the ERE sites of ERα-regulated genes, thereby increasing the transcription of these genes, such as MYC, UBe2C, and so on (Fig. 4). UBe2C has been identified as an ERα target gene to promote epithelial-mesenchymal transition in EC (
      • Liu Y.
      • Zhao R.
      • Chi S.
      • Zhang W.
      • Xiao C.
      • Zhou X.
      • et al.
      UBE2C Is Upregulated by Estrogen and Promotes Epithelial-Mesenchymal Transition via p53 in Endometrial Cancer.
      ). In concordance with this, our results have shown that UBe2C was also upregulated by USP14 in EC. Taken together, our results suggest that USP14 might act as the co-regulator of ERα, promoting the development of EC.
      In summary, this study has demonstrated that USP14 associates with ERα to maintain the stability of ERα through its deubiquitination activity with the K48-linkage poly-chain. USP14 leads to an enhancement of ERα recruitment on ERE regions of ERα downstream target genes, thereby upregulation ERα action. Moreover, depletion of USP14 or USP14 specific inhibitor treatment inhibits cell proliferation and migration in EC, indicating that USP14 may be a novel therapeutic target in EC treatment.

      Experimental Procedures

      Cell culture and reagents

      The human EC cell lines Ishikawa and HEC-1A were cultured in RPMI1640 (Gibco-BRL). HEK293 and COS7 cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco-BRL). All the culture media were contained 10% fetal bovine serum (FBS), penicillin (100U/ml) and streptomycin (100ng/ml) at 37°C with 5% CO2 in the incubator.
      USP14 inhibitor, IU1 and cycloheximide were ordered from Abmole. MTS was purchased from Promega. 17β-estradiol was obtained from Sigma. MG132 was bought from Selleck (CAS: 133407-82-6).

      Antibodies

      The antibodies in our research were anti-ERα (Cell Signaling Technology # 8644), anti-GAPDH (Shanghai Kangchen # KC5G4), anti-His (Proteintech # 66005-1-lg), anti-USP14 (Santa # sc-398099), anti-USP14 (Bethyl # A300-919A), anti-Ub (Proteintech # 10210-2-AP), anti-rabbit/mouse (ABclonal), anti-MYC (Proteintech # 10828-1-AP), anti-E2F1 (Proteintech # 66515-1-lg), anti-UBe2C (Proteintech # 66087-1-lg), and anti-IgG (Santa #sc-2025).

      Co-Immunoprecipitation and western blot analysis

      For exogenous Co-IP, COS7 cells were transfected with FLAG-USP14 and HA-ERα with jetPRIMETM DNA transfection reagent (Polyplus), after 4-6h, the cells were treated with E2 for 48h. The whole cell lysates were extracted after 48h. The lysates were incubated with anti-HA for 12h, and then with protein GsepharoseTM for 4h. The immunes complexes were detected with indicated antibodies. Endogenic Co-IP was the similar with the procedures above.
      Western blot analysis was performed by the standard process introduced in our previous study (
      • Shi W.
      • Yan D.
      • Zhao C.
      • Xiao M.
      • Wang Y.
      • Ma H.
      • et al.
      Inhibition of IL-6/STAT3 signaling in human cancer cells using Evista.
      ).

      RNA isolation, quantitative real-time PCR (qPCR)

      Cells transfected with siCtrl or siUSP14 for 24h were prepared for RNA isolation. Total RNA was extracted with Trizol (Vazyme) and cDNA was reversed using PrimeScript™ RT-PCR Kit. Then qPCR was performed with SYBR qPCR Master Mix(Vazyme) on LightCycler96 (Roche). All the primers used in our experiment were showed in the Table 1.
      Table 1The primer sequences for the indicated genes used in quantitative RT-PCR
      NameSense (F’)Anti-sense (R’)
      18STTGACGGAAGGGCACCACCAGCACCACCACCCACGGAAT
      USP14TGTGCCTGAACTCAAAGATGCATATACTGCGCTGAAGCCATTT
      ESR1CTAACTTGCTCTTGGACAGGACAGGACTCGGTGGATATGGT
      MycCGTCCTCGGATTCTCTGCTCGCTGGTGCATTTTCGGTTGT
      UBe2CGGATTTCTGCCTTCCCTGAAGATAGCAGGGCGTGAGGAAC
      E2F1CAGAGCAGATGGTTATGGTGAAGATGATGGTGGTGGTGACA

      siRNA transfection, and lentiviral infection

      siRNA was purchased from Sigma and the shUSP14 lentivirus was bought from Genechem. EC cells were transfected with them according to the protocol.

      Chromatin Immunoprecipitation (ChIP) assay

      ChIP assay was performed as our previous study showed (
      • Sun S.
      • Zhong X.
      • Wang C.
      • Sun H.
      • Wang S.
      • Zhou T.
      • et al.
      BAP18 coactivates androgen receptor action and promotes prostate cancer progression.
      ). Ishikawa cells were collected for ChIP assay after treated with E2 for 12h. IP of sonicated chromatin solutions was conducted by overnight incubation at 4°C rotate with anti-ERα or anti-USP14. Protein A was added to every sample the next day, and then the samples were washed with low salt buffer, high salt buffer, LiCl buffer and TE buffer. Then the complexes were eluted and purified. The DNA samples were then amplified by qPCR. The specific primers of c-Myc were sense: 5’-TTGACGGAAGGGCACCACCA-3’, antisense: 5’-GCACCACCACCCACGGAAT-3’.

      Cell growth, colony formation assay, and transwell assay

      For cell growth analysis, 4✕103 Ishikawa or HEC-1A were plated in 96-well plate, stimulated with 10-8M E2 or absolute ethanol. The cells were collected at indicated days and measured at an absorbance of 490nm.
      Colony formation assay was performed with Ishikawa cells and HEC-1A cells cultured with FBS 1640 RIPM. The cells were cultured in an atmosphere of 5% CO2 at 37°C for 14 days. PBS was used to wash the cells and then 4% polyformaldehyde was added into the plate to fix the cells for 20min. After that, the cells were stained with 1% crystal violet for 1h or overnight.
      Transwell assay was performed with Ishikawa cells. 3✕104 cells were seeded in the transwell chambers with the treatment of different concentrations of IU1. The indicated concentration of E2 was 10-8M. The cells were collected after 24h.

      Immunohistochemical assay (IHC)

      Paraffin sections (5-μm thick) of benign endometrial tissues (n=31) and endometrial cancer tissue samples (n =99) were deparaffinized, rehydrated, and antigen retrieval performed. After blocked with donkey serum overnight, the slides were incubated with rabbit anti-USP14 (1:2000 dilution) antibodies (
      • Lv C.
      • Wang S.
      • Lin L.
      • Wang C.
      • Zeng K.
      • Meng Y.
      • et al.
      USP14 maintains HIF1-alpha stabilization via its deubiquitination activity in hepatocellular carcinoma.
      ,
      • Kim H.T.
      • Goldberg A.L.
      The deubiquitinating enzyme Usp14 allosterically inhibits multiple proteasomal activities and ubiquitin-independent proteolysis.
      ). After washed in PBS, the sections were incubated with goat anti-rabbit IgG for 1 hour at room temperature, followed by visualization with diaminobenzidine of the expression of USP14 and visualization with hematoxylin of the nuclei. All the images were captured by an Olympus microscope. The samples were approved by the Human Research Ethics Committee of China Medical University.

      Xenograft tumor growth

      NOD/SCID mice were purchased from Vital River Laboratory. All the animal experiments were approved by the China Medical University of Animal Care Center. Ishikawa cells (1.0✕107 cells/mouse) stably expressing shCtrl or shUSP14 were subcutaneously inoculated into the 5-week-old female mice for each side. The mice were divided into two groups: one group was treated with placebo and the other group was orally treated with IU1 (40mg/kg/day) every 2 days. Tumor diameter was measured every week. Tumor volume (mm3) was calculated as volume = (short diameter)2 × (long diameter)/2 (
      • Zhang X.
      • Kyo S.
      • Nakamura M.
      • Mizumoto Y.
      • Maida Y.
      • Bono Y.
      • et al.
      Imatinib sensitizes endometrial cancer cells to cisplatin by targeting CD117-positive growth-competent cells.
      ).

      Patient samples

      Human normal endometrium and endometrial cancer tissues were obtained from the First Hospital of China Medical University. All of the EC samples we used for IHC assay are endometrioid adenocarcinoma, including stage I 86 cases (86.9%), stage II 7 cases (7%) and stage III 6 cases (6.1%). And all the samples were under patients’ informed contents.

      Statistics

      Unpaired Student’s t test was used to examine the statistical significance. Pearson correlation coefficient was used to test the expression level of USP14 and ERα. The overall survival and relapse free survival was calculated with Kaplan-Meier plotter. P value was calculated with Graph Pad Prism 8 and less than 0.05 was considered statistically significant.

      Data availability

      The data are included in the main file and supporting information.

      Supporting information

      This article contains supporting information.

      Conflict of interests

      The authors declare that they have no conflict of interest with the contents of this article.

      Acknowledgments

      We appreciate Dr. Yunlong Huo and Dr. Fang Dong for excellent technique assistance. We thanks Dr. Chi Lv for kind instruments support.

      Referenes

        • Ferlay J.
        • Soerjomataram I.
        • Dikshit R.
        • Eser S.
        • Mathers C.
        • Rebelo M.
        • et al.
        Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012.
        Int J Cancer. 2015; 136: E359-E386
        • Bray F.
        • Ferlay J.
        • Soerjomataram I.
        • Siegel R.L.
        • Torre L.A.
        • Jemal A.
        Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries.
        CA Cancer J Clin. 2018; 68: 394-424
        • Arend R.C.
        • Jones B.A.
        • Martinez A.
        • Goodfellow P.
        Endometrial cancer: Molecular markers and management of advanced stage disease.
        Gynecol Oncol. 2018; 150: 569-580
        • Siegel R.L.
        • Miller K.D.
        • Fuchs H.E.
        • Jemal A.
        Cancer Statistics, 2021.
        CA Cancer J Clin. 2021; 71: 7-33
        • Bokhman J.V.
        Two pathogenetic types of endometrial carcinoma.
        Gynecol Oncol. 1983; 15: 10-17
        • Carlson M.J.
        • Thiel K.W.
        • Leslie K.K.
        Past, present, and future of hormonal therapy in recurrent endometrial cancer.
        Int J Womens Health. 2014; 6: 429-435
        • Tecalco-Cruz A.C.
        • Ramirez-Jarquin J.O.
        • Cruz-Ramos E.
        Estrogen Receptor Alpha and its Ubiquitination in Breast Cancer Cells.
        Curr Drug Targets. 2019; 20: 690-704
        • Xia X.
        • Liao Y.
        • Huang C.
        • Liu Y.
        • He J.
        • Shao Z.
        • et al.
        Deubiquitination and stabilization of estrogen receptor alpha by ubiquitin-specific protease 7 promotes breast tumorigenesis.
        Cancer Lett. 2019; 465: 118-128
        • Tang J.
        • Luo Y.
        • Tian Z.
        • Liao X.
        • Cui Q.
        • Yang Q.
        • et al.
        TRIM11 promotes breast cancer cell proliferation by stabilizing estrogen receptor alpha.
        Neoplasia. 2020; 22: 343-351
        • Chen X.S.
        • Wang K.S.
        • Guo W.
        • Li L.Y.
        • Yu P.
        • Sun X.Y.
        • et al.
        UCH-L1-mediated Down-regulation of Estrogen Receptor alpha Contributes to Insensitivity to Endocrine Therapy for Breast Cancer.
        Theranostics. 2020; 10: 1833-1848
        • Yu F.
        • Liu J.B.
        • Wu Z.J.
        • Xie W.T.
        • Zhong X.J.
        • Hou L.K.
        • et al.
        Tumor suppressive microRNA-124a inhibits stemness and enhances gefitinib sensitivity of non-small cell lung cancer cells by targeting ubiquitin-specific protease 14.
        Cancer Lett. 2018; 427: 74-84
        • Sharma A.
        • Almasan A.
        USP14 Regulates DNA Damage Response and Is a Target for Radiosensitization in Non-Small Cell Lung Cancer.
        Int J Mol Sci. 2020; 21
        • Liu B.
        • Jiang S.
        • Li M.
        • Xiong X.
        • Zhu M.
        • Li D.
        • et al.
        Proteome-wide analysis of USP14 substrates revealed its role in hepatosteatosis via stabilization of FASN.
        Nat Commun. 2018; 9: 4770
        • Kim H.T.
        • Goldberg A.L.
        UBL domain of Usp14 and other proteins stimulates proteasome activities and protein degradation in cells.
        Proc Natl Acad Sci U S A. 2018; 115: E11642-E11650
        • Hanna J.
        • Hathaway N.A.
        • Tone Y.
        • Crosas B.
        • Elsasser S.
        • Kirkpatrick D.S.
        • et al.
        Deubiquitinating enzyme Ubp6 functions noncatalytically to delay proteasomal degradation.
        Cell. 2006; 127: 99-111
        • Liao Y.
        • Xia X.
        • Liu N.
        • Cai J.
        • Guo Z.
        • Li Y.
        • et al.
        Growth arrest and apoptosis induction in androgen receptor-positive human breast cancer cells by inhibition of USP14-mediated androgen receptor deubiquitination.
        Oncogene. 2018; 37: 1896-1910
        • Xu L.
        • Wang J.
        • Yuan X.
        • Yang S.
        • Xu X.
        • Li K.
        • et al.
        IU1 suppresses proliferation of cervical cancer cells through MDM2 degradation.
        Int J Biol Sci. 2020; 16: 2951-2963
        • Shen J.
        • Hong L.
        • Chen L.
        Ubiquitin-specific protease 14 regulates ovarian cancer cisplatin-resistance by stabilizing BCL6 oncoprotein.
        Biochemical and Biophysical Research Communications. 2020;
        • Wang D.
        • Ma H.
        • Zhao Y.
        • Zhao J.
        Ubiquitin-specific protease 14 is a new therapeutic target for the treatment of diseases.
        J Cell Physiol. 2021; 236: 3396-3405
        • Chandrashekar D.S.
        • Bashel B.
        • Balasubramanya S.A.H.
        • Creighton C.J.
        • Ponce-Rodriguez I.
        • Chakravarthi B.
        • et al.
        UALCAN: A Portal for Facilitating Tumor Subgroup Gene Expression and Survival Analyses.
        Neoplasia. 2017; 19: 649-658
        • Nagy A.
        • Munkacsy G.
        • Gyorffy B.
        Pancancer survival analysis of cancer hallmark genes.
        Sci Rep. 2021; 11: 6047
        • Lee B.H.
        • Lee M.J.
        • Park S.
        • Oh D.C.
        • Elsasser S.
        • Chen P.C.
        • et al.
        Enhancement of proteasome activity by a small-molecule inhibitor of USP14.
        Nature. 2010; 467: 179-184
        • Kravtsova-Ivantsiv Y.
        • Sommer T.
        • Ciechanover A.
        The lysine48-based polyubiquitin chain proteasomal signal: not a single child anymore.
        Angew Chem Int Ed Engl. 2013; 52: 192-198
        • Kim H.T.
        • Kim K.P.
        • Lledias F.
        • Kisselev A.F.
        • Scaglione K.M.
        • Skowyra D.
        • et al.
        Certain pairs of ubiquitin-conjugating enzymes (E2s) and ubiquitin-protein ligases (E3s) synthesize nondegradable forked ubiquitin chains containing all possible isopeptide linkages.
        J Biol Chem. 2007; 282: 17375-17386
        • Liao Y.
        • Liu N.
        • Hua X.
        • Cai J.
        • Xia X.
        • Wang X.
        • et al.
        Proteasome-associated deubiquitinase ubiquitin-specific protease 14 regulates prostate cancer proliferation by deubiquitinating and stabilizing androgen receptor.
        Cell Death Dis. 2017; 8e2585
        • Huang G.
        • Li L.
        • Zhou W.
        USP14 activation promotes tumor progression in hepatocellular carcinoma.
        Oncol Rep. 2015; 34: 2917-2924
        • Wu N.
        • Liu C.
        • Bai C.
        • Han Y.P.
        • Cho W.C.
        • Li Q.
        Over-expression of deubiquitinating enzyme USP14 in lung adenocarcinoma promotes proliferation through the accumulation of beta-catenin.
        Int J Mol Sci. 2013; 14: 10749-10760
        • Vogel R.I.
        • Pulver T.
        • Heilmann W.
        • Mooneyham A.
        • Mullany S.
        • Zhao X.
        • et al.
        USP14 is a predictor of recurrence in endometrial cancer and a molecular target for endometrial cancer treatment.
        Oncotarget. 2016; 7: 30962-30976
        • Wang S.
        • Luo H.
        • Wang C.
        • Sun H.
        • Sun G.
        • Sun N.
        • et al.
        RNF8 identified as a co-activator of estrogen receptor alpha promotes cell growth in breast cancer.
        Biochim Biophys Acta Mol Basis Dis. 2017; 1863: 1615-1628
        • Wang S.
        • Zhong X.
        • Wang C.
        • Luo H.
        • Lin L.
        • Sun H.
        • et al.
        USP22 positively modulates ERalpha action via its deubiquitinase activity in breast cancer.
        Cell Death Differ. 2020; 27: 3131-3145
        • Zeng K.
        • Wu Y.
        • Wang C.
        • Wang S.
        • Sun H.
        • Zou R.
        • et al.
        ASH2L is involved in promotion of endometrial cancer progression via upregulation of PAX2 transcription.
        Cancer Sci. 2020; 111: 2062-2077
        • Backes F.J.
        • Walker C.J.
        • Goodfellow P.J.
        • Hade E.M.
        • Agarwal G.
        • Mutch D.
        • et al.
        Estrogen receptor-alpha as a predictive biomarker in endometrioid endometrial cancer.
        Gynecol Oncol. 2016; 141: 312-317
        • Liu Y.
        • Zhao R.
        • Chi S.
        • Zhang W.
        • Xiao C.
        • Zhou X.
        • et al.
        UBE2C Is Upregulated by Estrogen and Promotes Epithelial-Mesenchymal Transition via p53 in Endometrial Cancer.
        Mol Cancer Res. 2020; 18: 204-215
        • Shi W.
        • Yan D.
        • Zhao C.
        • Xiao M.
        • Wang Y.
        • Ma H.
        • et al.
        Inhibition of IL-6/STAT3 signaling in human cancer cells using Evista.
        Biochem Biophys Res Commun. 2017; 491: 159-165
        • Sun S.
        • Zhong X.
        • Wang C.
        • Sun H.
        • Wang S.
        • Zhou T.
        • et al.
        BAP18 coactivates androgen receptor action and promotes prostate cancer progression.
        Nucleic Acids Res. 2016; 44: 8112-8128
        • Lv C.
        • Wang S.
        • Lin L.
        • Wang C.
        • Zeng K.
        • Meng Y.
        • et al.
        USP14 maintains HIF1-alpha stabilization via its deubiquitination activity in hepatocellular carcinoma.
        Cell Death Dis. 2021; 12: 803
        • Kim H.T.
        • Goldberg A.L.
        The deubiquitinating enzyme Usp14 allosterically inhibits multiple proteasomal activities and ubiquitin-independent proteolysis.
        J Biol Chem. 2017; 292: 9830-9839
        • Zhang X.
        • Kyo S.
        • Nakamura M.
        • Mizumoto Y.
        • Maida Y.
        • Bono Y.
        • et al.
        Imatinib sensitizes endometrial cancer cells to cisplatin by targeting CD117-positive growth-competent cells.
        Cancer Lett. 2014; 345: 106-114