Advertisement

Seawater fish use an electrogenic boric acid transporter, Slc4a11A, for boric acid excretion by the kidney

  • Akira Kato
    Correspondence
    To whom correspondence should be addressed: Akira Kato, 4259-B22 Nagatsuta-cho, Midori-ku, Yokohama 226-8501, Japan. Tel.: +81-45-924-5310; E-mail:
    Affiliations
    School of Life Science and Technology, Tokyo Institute of Technology, Yokohama 226-8501, Japan

    Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Yokohama 226-8501, Japan

    Center for Biological Resources and Informatics, Tokyo Institute of Technology, Yokohama 226-8501, Japan

    Department of Physiology and Biomedical Engineering, Mayo Clinic College of Medicine and Science, Rochester, MN, USA 55905
    Search for articles by this author
  • Yuuri Kimura
    Affiliations
    Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Yokohama 226-8501, Japan
    Search for articles by this author
  • Yukihiro Kurita
    Affiliations
    Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Yokohama 226-8501, Japan
    Search for articles by this author
  • Min-Hwang Chang
    Affiliations
    Department of Physiology and Biomedical Engineering, Mayo Clinic College of Medicine and Science, Rochester, MN, USA 55905
    Search for articles by this author
  • Koji Kasai
    Affiliations
    Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo 113-8657, Japan
    Search for articles by this author
  • Toru Fujiwara
    Affiliations
    Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo 113-8657, Japan
    Search for articles by this author
  • Taku Hirata
    Affiliations
    Department of Physiology and Biomedical Engineering, Mayo Clinic College of Medicine and Science, Rochester, MN, USA 55905
    Search for articles by this author
  • Hiroyuki Doi
    Affiliations
    Nifrel, Osaka Aquarium Kaiyukan Co., Ltd., Osaka 565-0826, Japan
    Search for articles by this author
  • Shigehisa Hirose
    Affiliations
    Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Yokohama 226-8501, Japan
    Search for articles by this author
  • Michael F. Romero
    Correspondence
    To whom correspondence should be addressed: Michael F. Romero, Mayo Clinic, 200 First St. SW, Rochester, MN 55905, USA. Tel.: +1-507-284- 8127;
    Affiliations
    Department of Physiology and Biomedical Engineering, Mayo Clinic College of Medicine and Science, Rochester, MN, USA 55905

    Nephrology & Hypertension, Mayo Clinic College of Medicine and Science, Rochester, MN, USA 55905

    O’Brien Urology Research Center, Mayo Clinic College of Medicine and Science, Rochester, MN, USA 55905
    Search for articles by this author
Open AccessPublished:November 23, 2022DOI:https://doi.org/10.1016/j.jbc.2022.102740

      Abstract

      Boric acid is a vital micronutrient in animals; however, excess amounts are toxic to them. Little is known about whole-body boric acid homeostasis in animals. Seawater contains 0.4 mM boric acid, and since marine fish drink seawater, their urinary system was used here as a model of the boric acid excretion system. We determined that the bladder urine of a euryhaline pufferfish (river pufferfish, Takifugu obscurus) acclimated to fresh water and seawater contained 0.020 and 19 mM of boric acid, respectively (a 950-fold difference), indicating the presence of a powerful excretory renal system for boric acid. Slc4a11 is a potential animal homolog of the plant boron transporter BOR1; however, mammalian Slc4a11 mediates H+ (OH) conductance, but does not transport boric acid. We found that renal expression of the pufferfish paralog of Slc4a11, Slc4a11A, was markedly induced after transfer from fresh water to seawater, and Slc4a11A was localized to the apical membrane of kidney tubules. When pufferfish Slc4a11A was expressed in Xenopus oocytes, exposure to media containing boric acid and a voltage clamp elicited whole-cell outward currents, a marked increase in pHi, and increased whole-cell boron content. Additionally, the activity of Slc4a11A was independent of extracellular Na+. These results indicate that pufferfish Slc4a11A is an electrogenic boric acid transporter that functions as a Na+-independent B(OH)4 uniporter, B(OH)3-OH cotransporter, or B(OH)3/H+ exchanger. These observations suggest that Slc4a11A is involved in the kidney tubular secretion of boric acid in seawater fish, probably induced by the negative membrane potential and low pH of urine.

      Keywords

      Abbreviations:

      Slc (solute carrier), SW (seawater), FW (fresh water), BW (brackish water)

      Introduction

      Boron is essential to higher plants, primarily as a component of the polysaccharide cell wall matrix (
      • O'Neill M.A.
      • Eberhard S.
      • Albersheim P.
      • Darvill A.G.
      Requirement of borate cross-linking of cell wall rhamnogalacturonan II for Arabidopsis growth.
      ). In vertebrates, boric acid is a vital micronutrient that is required for embryogenesis in zebrafish and Xenopus laevis (
      • Fort D.J.
      • Rogers R.L.
      • McLaughlin D.W.
      • Sellers C.M.
      • Schlekat C.L.
      Impact of boron deficiency on Xenopus laevis: a summary of biological effects and potential biochemical roles.
      ,
      • Rowe R.I.
      • Bouzan C.
      • Nabili S.
      • Eckhert C.D.
      The response of trout and zebrafish embryos to low and high boron concentrations is U-shaped.
      ). Boron plays beneficial roles in bone growth and maintenance, hormone function, brain function, arthritis amelioration, cancer risk reduction, and cell growth in mammals (
      • Nielsen F.H.
      Update on human health effects of boron.
      ,
      • Uluisik I.
      • Karakaya H.C.
      • Koc A.
      The importance of boron in biological systems.
      ,
      • Armstrong T.A.
      • Spears J.W.
      • Crenshaw T.D.
      • Nielsen F.H.
      Boron supplementation of a semipurified diet for weanling pigs improves feed efficiency and bone strength characteristics and alters plasma lipid metabolites.
      ,
      • Devirian T.A.
      • Volpe S.L.
      The physiological effects of dietary boron.
      ,
      • Park M.
      • Li Q.
      • Shcheynikov N.
      • Muallem S.
      • Zeng W.
      Borate transport and cell growth and proliferation. Not only in plants.
      ,
      • Park M.
      • Li Q.
      • Shcheynikov N.
      • Zeng W.
      • Muallem S.
      NaBC1 is a ubiquitous electrogenic Na+ -coupled borate transporter essential for cellular boron homeostasis and cell growth and proliferation.
      ); however, the biochemical mechanisms involved remain unclear. Nevertheless, high levels of boric acid are toxic to both plants and animals. In plants, boron toxicity reduces the growth and expansion of organs (
      • Miwa K.
      • Takano J.
      • Omori H.
      • Seki M.
      • Shinozaki K.
      • Fujiwara T.
      Plants tolerant of high boron levels.
      ,
      • Miwa K.
      • Fujiwara T.
      Boron transport in plants: co-ordinated regulation of transporters.
      ), whereas in humans, gastrointestinal, cardiovascular, hepatic, kidney, and central nervous system effects, as well as dermatitis, erythema, and death have been observed in children and adults exposed to ≥84 mg boron/kg (
      • Uluisik I.
      • Karakaya H.C.
      • Koc A.
      The importance of boron in biological systems.
      ,
      • Khaliq H.
      • Juming Z.
      • Ke-Mei P.
      The Physiological Role of Boron on Health.
      ,

      Nielsen, F. H. (1996) Boron. in Trace elements in human nutrition and health (World Health Organization, I. A. E. A. F. a. A. O. o. t. U. N. ed.), WHO, Geneva. pp 175-179

      ,
      • Howe P.D.
      A review of boron effects in the environment.
      ,
      • Litovitz T.L.
      • Klein-Schwartz W.
      • Oderda G.M.
      • Schmitz B.F.
      Clinical manifestations of toxicity in a series of 784 boric acid ingestions.
      ). The reported acute oral LD50 values in mice and rats are 600 and 460–900 mg boron/kg body weight, respectively (
      • Pfeiffer C.C.
      • Hallman L.F.
      • Gersh I.
      Boric acid ointment: a study of possible intoxication in the treatment of burns.
      ,
      • Weir Jr., R.J.
      • Fisher R.S.
      Toxicologic studies on borax and boric acid.
      ). The reported fish LC50 values are highly variable ranging from 3.63 to 1,000 mg boron/L under various test conditions (
      • Schoderboeck L.
      • Muhlegger S.
      • Losert A.
      • Gausterer C.
      • Hornek R.
      Effects assessment: boron compounds in the aquatic environment.
      ,

      Eisler, R. (1990) Boron hazards to fish, wildlife, and invertebrates: A synoptic review, US Department of the Interior, Fish and Wildlife Service

      ), and concentrations of 100–300 mg boron/L can cause the death of various aquatic vertebrates (

      Birge, W., and Black, J. A. (1977) Sensitivity of vertebrate embryos to boron compounds.

      ).
      Boron transporters (BORs) (
      • Nakagawa Y.
      • Hanaoka H.
      • Kobayashi M.
      • Miyoshi K.
      • Miwa K.
      • Fujiwara T.
      Cell-type specificity of the expression of Os BOR1, a rice efflux boron transporter gene, is regulated in response to boron availability for efficient boron uptake and xylem loading.
      ,
      • Takano J.
      • Noguchi K.
      • Yasumori M.
      • Kobayashi M.
      • Gajdos Z.
      • Miwa K.
      • Hayashi H.
      • Yoneyama T.
      • Fujiwara T.
      Arabidopsis boron transporter for xylem loading.
      ) and boric acid channels (Nodulin26-like intrinsic membrane proteins, NIPs) (
      • Takano J.
      • Wada M.
      • Ludewig U.
      • Schaaf G.
      • von Wiren N.
      • Fujiwara T.
      The Arabidopsis major intrinsic protein NIP5;1 is essential for efficient boron uptake and plant development under boron limitation.
      ,
      • Tanaka M.
      • Wallace I.S.
      • Takano J.
      • Roberts D.M.
      • Fujiwara T.
      NIP6;1 is a boric acid channel for preferential transport of boron to growing shoot tissues in Arabidopsis.
      ) have been cloned from the model plants, Arabidopsis thaliana and Oryza sativa. BOR1, a homolog of the solute carrier family 4 (Slc4; bicarbonate transporters) (
      • Romero M.F.
      • Chen A.P.
      • Parker M.D.
      • Boron W.F.
      The SLC4 family of bicarbonate (HCO3-) transporters.
      ), is considered a boron efflux transporter and is required for both efficient boron uptake (
      • Takano J.
      • Noguchi K.
      • Yasumori M.
      • Kobayashi M.
      • Gajdos Z.
      • Miwa K.
      • Hayashi H.
      • Yoneyama T.
      • Fujiwara T.
      Arabidopsis boron transporter for xylem loading.
      ) and tolerance to high boric acid concentrations (
      • Miwa K.
      • Takano J.
      • Omori H.
      • Seki M.
      • Shinozaki K.
      • Fujiwara T.
      Plants tolerant of high boron levels.
      ,
      • Sutton T.
      • Baumann U.
      • Hayes J.
      • Collins N.C.
      • Shi B.J.
      • Schnurbusch T.
      • Hay A.
      • Mayo G.
      • Pallotta M.
      • Tester M.
      • Langridge P.
      Boron-toxicity tolerance in barley arising from efflux transporter amplification.
      ). Conversely, NIPs are homologous to aquaporins and aquaglyceroporins (AQP, water channels) (
      • Takano J.
      • Wada M.
      • Ludewig U.
      • Schaaf G.
      • von Wiren N.
      • Fujiwara T.
      The Arabidopsis major intrinsic protein NIP5;1 is essential for efficient boron uptake and plant development under boron limitation.
      ,
      • Tanaka M.
      • Wallace I.S.
      • Takano J.
      • Roberts D.M.
      • Fujiwara T.
      NIP6;1 is a boric acid channel for preferential transport of boron to growing shoot tissues in Arabidopsis.
      ). In root cells, boric acid enters the root cytosol via NIP5;1 (boric acid uptake channel) in the soil solution. In the stele, boric acid is loaded into the xylem by BOR1 in the cytosol of root cells (
      • Tanaka M.
      • Fujiwara T.
      Physiological roles and transport mechanisms of boron: perspectives from plants.
      ). The potential mammalian homolog of BOR1 is Slc4a11 (bicarbonate transporter-related protein, BTR1) (
      • Park M.
      • Li Q.
      • Shcheynikov N.
      • Zeng W.
      • Muallem S.
      NaBC1 is a ubiquitous electrogenic Na+ -coupled borate transporter essential for cellular boron homeostasis and cell growth and proliferation.
      ,
      • Parker M.D.
      • Ourmozdi E.P.
      • Tanner M.J.
      Human BTR1, a new bicarbonate transporter superfamily member and human AE4 from kidney.
      ). Human SLC4A11 was initially characterized as a Na+-coupled borate cotransporter, NaBC1 (
      • Park M.
      • Li Q.
      • Shcheynikov N.
      • Zeng W.
      • Muallem S.
      NaBC1 is a ubiquitous electrogenic Na+ -coupled borate transporter essential for cellular boron homeostasis and cell growth and proliferation.
      ); however, recent studies have shown that human and mouse Slc4a11 display H+/OH transport in both a Na+-independent and Na+-coupled mode, but do not transport B(OH)4 or HCO3 (
      • Jalimarada S.S.
      • Ogando D.G.
      • Vithana E.N.
      • Bonanno J.A.
      Ion Transport Function of SLC4A11 in Corneal Endothelium.
      ,
      • Kao L.
      • Azimov R.
      • Abuladze N.
      • Newman D.
      • Kurtz I.
      Human SLC4A11-C functions as a DIDS-stimulatable H+(OH-) permeation pathway: partial correction of R109H mutant transport.
      ,
      • Kao L.
      • Azimov R.
      • Shao X.M.
      • Frausto R.F.
      • Abuladze N.
      • Newman D.
      • Aldave A.J.
      • Kurtz I.
      Multifunctional ion transport properties of human SLC4A11: comparison of the SLC4A11-B and SLC4A11-C variants.
      ,
      • Kao L.
      • Azimov R.
      • Shao X.M.
      • Abuladze N.
      • Newman D.
      • Zhekova H.
      • Noskov S.
      • Pushkin A.
      • Kurtz I.
      SLC4A11 function: evidence for H+ (OH-) and NH3-H+ transport.
      ,
      • Loganathan S.K.
      • Schneider H.P.
      • Morgan P.E.
      • Deitmer J.W.
      • Casey J.R.
      Functional assessment of SLC4A11, an integral membrane protein mutated in corneal dystrophies.
      ,
      • Myers E.J.
      • Marshall A.
      • Jennings M.L.
      • Parker M.D.
      Mouse Slc4a11 expressed in Xenopus oocytes is an ideally selective H+/OH- conductance pathway that is stimulated by rises in intracellular and extracellular pH.
      ,
      • Ogando D.G.
      • Jalimarada S.S.
      • Zhang W.
      • Vithana E.N.
      • Bonanno J.A.
      SLC4A11 is an EIPA-sensitive Na+ permeable pHi regulator.
      ,
      • Quade B.N.
      • Marshall A.
      • Parker M.D.
      pH dependence of the Slc4a11-mediated H(+) conductance is influenced by intracellular lysine residues and modified by disease-linked mutations.
      ). In addition, human SLC4A11 mediates water and ammonium transport (
      • Kao L.
      • Azimov R.
      • Shao X.M.
      • Abuladze N.
      • Newman D.
      • Zhekova H.
      • Noskov S.
      • Pushkin A.
      • Kurtz I.
      SLC4A11 function: evidence for H+ (OH-) and NH3-H+ transport.
      ,
      • Vilas G.L.
      • Loganathan S.K.
      • Liu J.
      • Riau A.K.
      • Young J.D.
      • Mehta J.S.
      • Vithana E.N.
      • Casey J.R.
      Transmembrane water-flux through SLC4A11: a route defective in genetic corneal diseases.
      ,
      • Zhang W.
      • Ogando D.G.
      • Bonanno J.A.
      • Obukhov A.G.
      Human SLC4A11 Is a Novel NH3/H+ Co-transporter.
      ). SLC4A11 mutations cause recessive congenital hereditary endothelial dystrophy (CHED2), Fuchs’ dystrophy, and Harboyan syndrome (
      • Vithana E.N.
      • Morgan P.
      • Sundaresan P.
      • Ebenezer N.D.
      • Tan D.T.
      • Mohamed M.D.
      • Anand S.
      • Khine K.O.
      • Venkataraman D.
      • Yong V.H.
      • Salto-Tellez M.
      • Venkatraman A.
      • Guo K.
      • Hemadevi B.
      • Srinivasan M.
      • Prajna V.
      • Khine M.
      • Casey J.R.
      • Inglehearn C.F.
      • Aung T.
      Mutations in sodium-borate cotransporter SLC4A11 cause recessive congenital hereditary endothelial dystrophy (CHED2).
      ,
      • Kumar A.
      • Bhattacharjee S.
      • Prakash D.R.
      • Sadanand C.S.
      Genetic analysis of two Indian families affected with congenital hereditary endothelial dystrophy: two novel mutations in SLC4A11.
      ,
      • Ramprasad V.L.
      • Ebenezer N.D.
      • Aung T.
      • Rajagopal R.
      • Yong V.H.
      • Tuft S.J.
      • Viswanathan D.
      • El-Ashry M.F.
      • Liskova P.
      • Tan D.T.
      • Bhattacharya S.S.
      • Kumaramanickavel G.
      • Vithana E.N.
      Novel SLC4A11 mutations in patients with recessive congenital hereditary endothelial dystrophy (CHED2). Mutation in brief #958.
      ,
      • Sultana A.
      • Garg P.
      • Ramamurthy B.
      • Vemuganti G.K.
      • Kannabiran C.
      Mutational spectrum of the SLC4A11 gene in autosomal recessive congenital hereditary endothelial dystrophy.
      ,
      • Desir J.
      • Abramowicz M.
      Congenital hereditary endothelial dystrophy with progressive sensorineural deafness (Harboyan syndrome).
      ,
      • Vithana E.N.
      • Morgan P.E.
      • Ramprasad V.
      • Tan D.T.
      • Yong V.H.
      • Venkataraman D.
      • Venkatraman A.
      • Yam G.H.
      • Nagasamy S.
      • Law R.W.
      • Rajagopal R.
      • Pang C.P.
      • Kumaramanickevel G.
      • Casey J.R.
      • Aung T.
      SLC4A11 mutations in Fuchs endothelial corneal dystrophy.
      ,
      • Riazuddin S.A.
      • Vithana E.N.
      • Seet L.F.
      • Liu Y.
      • Al-Saif A.
      • Koh L.W.
      • Heng Y.M.
      • Aung T.
      • Meadows D.N.
      • Eghrari A.O.
      • Gottsch J.D.
      • Katsanis N.
      Missense mutations in the sodium borate cotransporter SLC4A11 cause late-onset Fuchs corneal dystrophy.
      ,
      • Vilas G.L.
      • Loganathan S.K.
      • Quon A.
      • Sundaresan P.
      • Vithana E.N.
      • Casey J.
      Oligomerization of SLC4A11 protein and the severity of FECD and CHED2 corneal dystrophies caused by SLC4A11 mutations.
      ). Slc4a11−/− mice exhibit abnormal auditory brain responses, vestibular-evoked potential waveforms (
      • Lopez I.A.
      • Rosenblatt M.I.
      • Kim C.
      • Galbraith G.C.
      • Jones S.M.
      • Kao L.
      • Newman D.
      • Liu W.
      • Yeh S.
      • Pushkin A.
      • Abuladze N.
      • Kurtz I.
      Slc4a11 gene disruption in mice: cellular targets of sensorineuronal abnormalities.
      ), increased corneal thickness, and corneal edema (
      • Vilas G.L.
      • Loganathan S.K.
      • Liu J.
      • Riau A.K.
      • Young J.D.
      • Mehta J.S.
      • Vithana E.N.
      • Casey J.R.
      Transmembrane water-flux through SLC4A11: a route defective in genetic corneal diseases.
      ,
      • Lopez I.A.
      • Rosenblatt M.I.
      • Kim C.
      • Galbraith G.C.
      • Jones S.M.
      • Kao L.
      • Newman D.
      • Liu W.
      • Yeh S.
      • Pushkin A.
      • Abuladze N.
      • Kurtz I.
      Slc4a11 gene disruption in mice: cellular targets of sensorineuronal abnormalities.
      ).
      Although marine teleosts (bony fish) live in seawater (SW; ∼450 mM NaCl, ∼50 mM Mg2+, ∼30 mM SO42−, 10 mM Ca2+, 10 mM K+, etc.), marine fish blood is hypoosmotic to SW. To avoid dehydration, marine fish drink large amounts of SW, absorb water and electrolytes in the intestine, and excrete excess electrolytes back into the SW via the gills (branchial chloride cells) (e.g., Na+ Cl and K+) or into the urine via the kidneys (e.g., Mg2+ and SO42−) (

      Marshall, W., and Grosell M. (2006) Ion transport, osmoregulation, and acid-base balance. in The Physiology of Fishes (Evans, D. H., and Claiborne, JB ed.), CRC, New York. pp 177-230

      ). In the kidney, the glomeruli of SW fish filter considerably less blood and produce much less primary urine than their FW counterparts, and tubular secretion largely contributes to urine production in SW fish (

      Marshall, W., and Grosell M. (2006) Ion transport, osmoregulation, and acid-base balance. in The Physiology of Fishes (Evans, D. H., and Claiborne, JB ed.), CRC, New York. pp 177-230

      ,

      Hickman Jr, C. P., and Trump, B. F. (1969) 2 The Kidney. in Fish physiology, Elsevier. pp 91-239

      ,
      • Kato A.
      • Nagashima A.
      • Hosono K.
      • Romero M.F.
      Membrane Transport Proteins Expressed in the Renal Tubular Epithelial Cells of Seawater and Freshwater Teleost Fishes.
      ). Their proximal tubules actively secrete fluids containing Mg2+, SO42−, and Cl into the tubular lumen (
      • Beyenbach K.W.
      Kidneys sans glomeruli.
      ,
      • Beyenbach K.W.
      • Petzel D.H.
      • Cliff W.H.
      Renal proximal tubule of flounder. I. Physiological properties.
      ). The collecting ducts may then actively reabsorb water along with Na+ and Cl to reduce urine volume, producing a relatively small volume of isotonic urine with high concentrations of Mg2+ and SO42−. SW also contains ∼0.4 mM boric acid (∼4.5 mg boron/L). Thus, SW fish are exposed to a continuous influx of boric acid that must be excreted. To discover how SW fish excrete boric acid, we used two closely related pufferfish: river pufferfish (Takifugu obscurus, euryhaline) and tiger pufferfish (Takifugu rubripes, marine) (
      • Kato A.
      • Doi H.
      • Nakada T.
      • Sakai H.
      • Hirose S.
      Takifugu obscurus is a euryhaline fugu species very close to Takifugu rubripes and suitable for studying osmoregulation.
      ), whose genome has been sequenced (
      • Aparicio S.
      • Chapman J.
      • Stupka E.
      • Putnam N.
      • Chia J.M.
      • Dehal P.
      • Christoffels A.
      • Rash S.
      • Hoon S.
      • Smit A.
      • Gelpke M.D.
      • Roach J.
      • Oh T.
      • Ho I.Y.
      • Wong M.
      • Detter C.
      • Verhoef F.
      • Predki P.
      • Tay A.
      • Lucas S.
      • Richardson P.
      • Smith S.F.
      • Clark M.S.
      • Edwards Y.J.
      • Doggett N.
      • Zharkikh A.
      • Tavtigian S.V.
      • Pruss D.
      • Barnstead M.
      • Evans C.
      • Baden H.
      • Powell J.
      • Glusman G.
      • Rowen L.
      • Hood L.
      • Tan Y.H.
      • Elgar G.
      • Hawkins T.
      • Venkatesh B.
      • Rokhsar D.
      • Brenner S.
      Whole-genome shotgun assembly and analysis of the genome of Fugu rubripes.
      ). By comparing the gene expression between FW- and SW-acclimated pufferfish, renal and intestinal ion transporters that are involved in HCO3, Ca2+, Mg2+, and SO42− excretion for SW acclimation were identified (
      • Kato A.
      • Nagashima A.
      • Hosono K.
      • Romero M.F.
      Membrane Transport Proteins Expressed in the Renal Tubular Epithelial Cells of Seawater and Freshwater Teleost Fishes.
      ,
      • Islam Z.
      • Hayashi N.
      • Inoue H.
      • Umezawa T.
      • Kimura Y.
      • Doi H.
      • Romero M.F.
      • Hirose S.
      • Kato A.
      Identification and lateral membrane localization of cyclin M3, likely to be involved in renal Mg2+ handling in seawater fish.
      ,
      • Kato A.
      • Chang M.H.
      • Kurita Y.
      • Nakada T.
      • Ogoshi M.
      • Nakazato T.
      • Doi H.
      • Hirose S.
      • Romero M.F.
      Identification of renal transporters involved in sulfate excretion in marine teleost fish.
      ,
      • Kurita Y.
      • Nakada T.
      • Kato A.
      • Doi H.
      • Mistry A.C.
      • Chang M.H.
      • Romero M.F.
      • Hirose S.
      Identification of intestinal bicarbonate transporters involved in formation of carbonate precipitates to stimulate water absorption in marine teleost fish.
      ). By searching for ion transporters upregulated in SW, we found that an Slc4a11 paralog, Slc4a11A, had high renal expression and was upregulated during SW acclimation. Functional characterization (electrophysiology) and immunohistochemistry caused us to hypothesize that Slc4a11A is an electrogenic boric acid transporter that plays a central role in excess boric acid excretion at the apical membrane of marine teleost renal tubules. These observations suggest that SW fish excrete excessive boric acid (acquired from drinking SW) into the urine via Slc4a11A, thereby avoiding boric acid toxicity and simultaneously maintaining low plasma boric acid levels. To the best of our knowledge, this study is the first characterization of a boric acid excretion mechanism in an animal, as well as the first demonstration of the presence of an electrogenic boric acid transporter.

      Results

      Boric acid excretion by pufferfish kidney in SW.

      Boric acid (B(OH)3, pKa 9.24) is in equilibrium with borate (B(OH)4) in aqueous solutions. Hereafter, the term “boric acid” refers to the combination of both forms, and the term “borate” refers specifically to molecular species B(OH)4. When referring to B(OH)3, we specifically state “B(OH)3.” [Boron] was determined by analyzing trace elements derived from boric acid and all other compounds containing boron.
      The natural SW used in this study contained 0.45 ± 0.02 mM boric acid (n = 3). The SW-acclimated river and tiger pufferfish contained intestinal or rectal fluids derived from ingested SW. The boric acid concentrations of all intestinal and rectal fluids were 0.15 ± 0.12 mM (n = 4) and 0.04 ± 0.02 mM (n = 4) in the SW-acclimated river and tiger pufferfish, respectively, and were significantly lower than that of SW (P < 0.0002) (Fig. 1), suggesting the presence of intestinal boric acid absorption by these fish. Intestinal and rectal fluids were not present in the intestines of FW-acclimated river pufferfish and BW-acclimated tiger pufferfish.
      Figure thumbnail gr1
      Figure 1Urinary boric acid excretion by pufferfish in seawater (SW). Boric acid or boron concentrations of serum (n = 4–6), urine (n = 6–7), and rectal fluid (n = 4) of pufferfish acclimated to brackish water (BW), fresh water (FW), and natural SW are shown. Dots represent individual data. Bar graphs represent means ± SD. * P < 0.0001, ** P < 0.0002, * P < 0.05.
      The serum [boron] of FW-acclimated river pufferfish was 6.0 ± 1.2 μM (n = 4, Fig. 1); [boron] refers to the total concentration of various boron forms expressed as boric acid equivalents. In SW, the serum [boron] increased to 57 ± 35 μM (n = 6), which was 9.5 times higher than that of river pufferfish in FW (P < 0.02). The serum [boron] of SW-acclimated tiger pufferfish was 24 ± 10 μM (n = 4), which was three times higher than that of tiger pufferfish in BW of 7.9 ± 1.7 μM (n = 4, P < 0.02). These results indicate that the [boric acid]blood of pufferfish in SW was slightly higher than those of pufferfish in FW and BW, and that SW pufferfish maintained their [boric acid]blood levels 7.9–19 times lower than that of marine [boric acid].
      Bladder urine from river pufferfish in FW contained 20 ± 19 μM boric acid (n = 7). Interestingly, the bladder urine of river pufferfish in SW contained 19 ± 8.3 milli-M (n = 6) boric acid (i.e., three orders of magnitude difference). In other words, the [boric acid]urine of SW-acclimated river pufferfish was ∼950-fold greater than that of FW-acclimated fish (P < 0.0001), 330-fold greater than [boric acid]blood, and 41-fold greater than [boric acid]SW (Fig. 1). Similar results were obtained with tiger pufferfish. Bladder urine of tiger pufferfish in SW contained 14 ± 4.5 mM boric acid (n = 5), which was ∼140-fold greater than that of BW-acclimated fish (P < 0.0001), 590-fold greater than [boric acid]blood, and 31-fold greater than [boric acid]SW. These results indicate that the SW pufferfish kidney has the ability to excrete and concentrate boric acid into the urine.

      Isolation and tissue distribution of Slc4a11A and Slc4a11B.

      We sought to investigate which transporter is involved in renal boric acid excretion into the urine. Two protein homologs of plant boron transporter (BOR) were identified from the database of the Takifugu genome: Slc4a11A (820 aa), and Slc4a11B (844 aa). The phylogenetic relationships are shown in Fig. 2A and the multiple alignment of amino acid sequences are shown in Fig. 3. Among the pufferfish tissues, Slc4a11A transcripts were notably high in the kidneys, whereas Slc4a11B transcripts were found at low levels in a broad range of tissues (Fig. 2B). Renal Slc4a11A expression in river pufferfish in SW was 1.6-fold higher than that of the fish in FW (Fig. 2C).
      Figure thumbnail gr2
      Figure 2Renal expression of Slc4a11A. (A) Phylogenetic tree of boric acid transporters in relation to the other human SLC4 family members. The boric acid transport activity of Takifugu Slc4a11A is shown in this study. Scale bar, 0.1 amino acid substitution per site. c, chicken; z, zebrafish; AE, anion exchanger; NBC, Na+-HCO3 cotransporter; NDCBE, Na+-driven Cl/HCO3 exchanger. (B) Tissue distribution of Slc4a11A and -B. Semiquantitative RT-PCR was performed on various tissues of river pufferfish. F, FW; S, SW. Numbers indicate PCR cycles. Results from 27 PCR cycles show tissues with relatively high expression of the indicated genes, and those of 32 cycles show all tissues expressing the indicated genes from low to high levels. (111, 162, 65) (C) Real-time PCR quantification of mRNAs for Slc4a11A and -B in the kidneys of river pufferfish acclimated to FW and SW. Values are expressed relative to GAPDH. Dots represent individual data. Bar graphs represent means ± SD, n = 5. * P < 0.05. (D) In situ hybridization of Slc4a11A and -B in the kidney of river pufferfish in SW. Sense probes did not show labeling (data not shown).
      Figure thumbnail gr3
      Figure 3Multiple alignment of amino acid sequences of Slc4a11 family. The amino acid residues that are conserved among Slc4a11 family members are shaded. Transmembrane (TM) regions are indicated by solid bars labeled as TM1-TM12. mf, mefugu; h, human. The accession numbers of mfSlc4a11A, mfSlc4a11B, and hSLC4A11 are AB534190, AB534191, and NM_032034, respectively.
      In situ hybridization histochemistry of kidney sections of SW-acclimated river pufferfish showed that Slc4a11A mRNA was highly concentrated in the renal tubules (Fig. 2D), whereas Slc4a11B mRNA was distributed in various renal cells, including a large number of non-epithelial cells, at low levels (Fig. 2D). This indicated that the major paralog in the renal tubules was Slc4a11A.

      Apical membrane localization of Slc4a11A in renal tubular cells.

      To determine the subcellular localization of the Slc4a11A protein, a polyclonal antiserum was raised against a synthetic polypeptide based on the cytoplasmic Slc4a11A COOH-terminus (Fig. 3). The antibody recognized both Slc4a11A and -B expressed in HEK293 cells (Fig. 4A). Incubation of the membrane fraction of HEK293 cells with glycosidases shifted the bands from ∼180 kDa to ∼120 kDa (Fig. 4A).
      Figure thumbnail gr4
      Figure 4(A) Western blot analysis of HEK293 cells transfected with pcDNA3 (mock), pcDNA3-Slc4a11A, or pcDNA3-Slc4a11B. The membrane fractions of the cells were incubated with (+) or without (–) glycosidases, and analyzed using anti-Slc4a11 antiserum (left) and antigen-absorbed antiserum (right). (B) Polarized distribution of Slc4a11A and -B in MDCK cells. Anti-Slc4a11 antiserum (green), anti-ZO-1 antibody (red), and Hoechst 33342 (blue) were used to stain MDCK cells transiently transfected with pcDNA3 (mock), pcDNA3-Slc4a11A, or pcDNA3-Slc4a11B. Confocal XY maximum projection image and XZ (vertical) sections are shown.
      When Slc4a11A or -B were expressed in MDCK-polarized epithelial cells, both were localized at the apical membrane (Fig. 4B). Immunoreactivity was not detected when preimmune serum or antigen-absorbed antiserum was used (Fig. 4C), showing that the antibody specifically recognized Slc4a11A or -B expressed in MDCK cells.
      We next stained the kidney sections of SW-acclimated river pufferfish with anti-Slc4a11 antibody. The nephrons of river pufferfish consist of a renal corpuscle, proximal tubule, distal tubule, and collecting duct (
      • Kato A.
      • Muro T.
      • Kimura Y.
      • Li S.
      • Islam Z.
      • Ogoshi M.
      • Doi H.
      • Hirose S.
      Differential expression of Na+-Cl- cotransporter and Na+-K+-Cl- cotransporter 2 in the distal nephrons of euryhaline and seawater pufferfishes.
      ). Previously, we identified these segments by the expression of molecular markers: the proximal tubule was identified by the presence of a brush border membrane and the absence of Na+-K+-2Cl-cotransporter 2 (Nkcc2 or Slc12a1) and Na+-Cl-cotransporter (Ncc or Slc12a3) expression; the distal tubule was identified by the absence of a brush border membrane and the presence of Nkcc2 expression; the collecting duct was identified by the absence of a brush border membrane and the presence of Ncc expression. In the same study, we also showed that all proximal tubules, distal tubules, and collecting ducts expressed Na+/K+-ATPase at high levels in the basolateral membrane, and immunostaining of Na+/K+-ATPase could visualize the difference in structure of the basolateral infoldings of the plasma membrane. Therefore, the segments can be distinguished by the shape of tubular cells and the immunostaining pattern of Na+/K+-ATPas. Proximal tubular cells are cuboidal epithelial cells with shallow basolateral infoldings, while distal tubular cells are cuboidal epithelial cells with deep basolateral infoldings, and collecting duct cells are columnar epithelial cells with deep basolateral infoldings (
      • Kato A.
      • Muro T.
      • Kimura Y.
      • Li S.
      • Islam Z.
      • Ogoshi M.
      • Doi H.
      • Hirose S.
      Differential expression of Na+-Cl- cotransporter and Na+-K+-Cl- cotransporter 2 in the distal nephrons of euryhaline and seawater pufferfishes.
      ). In the kidney sections of SW-acclimated river pufferfish, Slc4a11 was localized at the apical membranes of the proximal tubules and collecting ducts (Fig. 5), but not in the distal tubules (data not shown). Immunoreactivity was not detected when pre-immune serum or antigen-absorbed antiserum was used (Fig. 5). This positive staining likely represents the Slc4a11A protein because the cells were almost identical to those identified by in situ hybridization histochemistry of Slc4a11A. Therefore, we focused on Slc4a11A for further functional characterization.
      Figure thumbnail gr5
      Figure 5Immunolocalization of Slc4a11 in renal tubules of SW-acclimated river pufferfish. Serial frozen sections of mefugu kidney were stained with anti-Slc4a11 antiserum (A, C) or antigen-absorbed anti-Slc4a11 antiserum (B, D) (green), anti-Na+-K+-ATPase (NKA) antibody (red), and Hoechst (blue). p, proximal tubule; c, collecting duct. Bars: 20 μm.

      Electrogenic boric acid transport activity of Slc4a11A expressed in Xenopus oocytes.

      Slc4a11A-mediated boric acid movement across the plasma membrane was initially suggested as boric acid-elicited whole-cell currents and changes in pHi in Xenopus oocytes by pH microelectrode analysis during Vm clamping (Fig. 6A). In Slc4a11A oocytes, but not in water-injected (control) oocytes, a significant positive outward Iboric acid (+0.27 ± 0.03 μA, n = 4; anion influx) was elicited by the addition of 20 mM boric acid in the bath solution, which was reversed (−0.46 ± 0.10 μA, n = 4; anion efflux) by its removal (Fig. 6A, upper panel). Exposure to 20 mM boric acid also caused a marked increase in pHi (alkalinization: +62 ± 22 × 10-5 pH units/s, n = 3) (Fig. 6A, lower panel). Conversely, water-injected oocytes did not show significant pHi changes when exposed to 20 mM boric acid (Fig. 6A, right).
      Figure thumbnail gr6
      Figure 6Boric acid transport mediated by Slc4a11A. (A) Representative traces of boric acid-elicited currents and changes in intracellular pH of voltage-clamped oocytes (holding potential Vh: −60 mV) injected with Slc4a11A or water (control). (B) Current–voltage (I–V) relationships of oocytes expressing Slc4a11A and control oocytes in the presence or absence of 20 mM boric acid. Values are means ± SD, n = 5–8. (C) Representative traces of boric acid-elicited changes of membrane potential (Vm) of oocytes injected with Slc4a11A and water (control). (D) Michaelis–Menten curve fitted to boric acid-elicited currents of oocytes expressing Slc4a11A at +60 mV. Boric acid-elicited currents were measured by the addition of 1, 3, 5, 10, and 20 mM boric acid, and were calculated as I(boric acid) – I(no boric acid). Maximum current (Imax) and Michaelis–Menten constant (Km) are shown. Values are means ± SEM, n = 3. (E) Boric acid uptake by voltage-clamped oocytes. Slc4a11A oocytes and control oocytes were voltage clamped (Vh: 0 mV) in ND96 containing 10 mM boric acid for 10 min, and the amount of boron in each oocyte was measured by ICP-MS. Dots represent individual data. Bar graphs represent means ± SD, n = 6. (F) Time course of boric acid uptake by unclamped oocytes. Oocytes were incubated in an ND96 medium containing 20 mM boric acid for 30, 60, and 90 min, and the amount of boron in each oocyte was measured by ICP-MS. Values are means ± SD, n = 4. (G) Boric acid uptake by unclamped oocytes. Oocytes were incubated in test solutions for 24–40 h, and the amount of boron in each oocyte was measured by ICP-MS. Dots represent individual data. Bar graphs represent means ± SD, n = 4. No VC, unclamped. (H) Rates of boric acid influx in voltage-clamped (Vh: 0 mV) and unclamped oocytes. The rates were calculated from data shown in (E) and (F). Dots represent individual data. Bar graphs represent means ± SD, n = 4–6. (I) Time course of boric acid efflux by unclamped oocyte. Oocytes were incubated in an ND96 medium containing 20 mM boric acid for 24 h until saturated, followed by incubation in ND96 for 5, 10, and 20 min, and the amount of boron in each oocyte was measured by ICP-MS. Values are means ± SD, n = 4.
      The current–voltage (I–V) relationship is shown in Fig. 6B. Exposure to boric acid medium elicited whole-cell currents and shifted the reversal potential (Fig. 6B). When the membrane potential (Vm) was not clamped, boric acid medium elicited a hyperpolarization (ΔVm) in Slc4a11A oocytes (−85.0 ± 5.6 mV, n = 4) but not in control oocytes (−2.1 ± 0.3 mV, n = 4) (Fig. 6C). The boric acid-elicited currents were dose-dependently increased, and the Michaelis–Menten constant (Km) for Slc4a11A was 6.5 ± 0.6 mM (Vh = +60 mV, pH 7.5) for boric acid (Fig. 6D). The Imax was 1.5 ± 0.05 μA.
      To directly measure Slc4a11A-mediated boric acid movement across the plasma membrane, the boron content of the oocytes was determined using ICP-MS (Fig. 6E). In the absence of boric acid in the medium, the whole boron content of the Slc4a11A and control oocytes were 0.27 ± 0.16 (n = 6) and 0.14 ± 0.09 (n = 5), respectively. After incubating oocytes in a medium containing 10 mM boric acid (Vh = 0 mV for 10 min), the whole boron content of the Slc4a11A oocyte (1.8 ± 0.26 nmol/cell) was significantly higher than that of the water-injected oocytes (0.47 ± 0.09 nmol/cell, P < 0.001, n = 6), indicating the presence of Slc4a11A-mediated boric acid movement across the plasma membrane. In the absence of a voltage clamp, a longer incubation time (∼90 min) was needed to detect a significant increase in the intracellular boron content (Figs. 6F). The intracellular boron content of both Slc4a11A and control oocytes was saturated after 24 h incubation in boric acid media (Fig. 6G). This result shows that the plasma membrane of control oocytes has weak permeability to boric acid. Boron accumulation was completely inhibited when the boric acid medium contained NMDG (Fig. 6G). This inhibition was observed with both Slc4a11A and control oocytes, likely due to the NMDG-chelating boric acid (
      • Oshita K.
      • Seo K.
      • Sabarudin A.
      • Oshima M.
      • Takayanagi T.
      • Motomizu S.
      Synthesis of chitosan resin possessing a phenylarsonic acid moiety for collection/concentration of uranium and its determination by ICP-AES.
      ,
      • Tural B.
      Separation and Preconcentration of Boron with a Glucamine Modified Novel Magnetic Sorbent.
      ). The boric acid flux rate per unit time in voltage-clamped Slc4a11A oocytes (Vh = 0 mV) was higher than that in unclamped Slc4a11A oocytes (Fig. 6H). Boric acid efflux was analyzed by placing boric-acid-saturated oocytes in boric acid-free medium. Slc4a11A oocytes more quickly reduced intracellular boric acid than the control oocytes (Fig. 6I). These results showed that Slc4a11A is an electrogenic boric acid transporter and that its negative membrane potential inhibits the boric acid influx activity of Slc4a11A.

      Slc4a11A is a B(OH)4 uniporter, a B(OH)3-OH cotransporter, or a B(OH)3/H+ exchanger.

      To determine whether Slc4a11A uses Na+-dependent cotransport, we replaced all Na+ in the media with various monovalent cations (choline+, NMDG+, Li+, K+, or NH4+) and compared the resulting boric-acid-elicited currents in Slc4a11A-expressing Xenopus oocytes. Boric-elicited currents were also observed in Na+-free solutions containing choline+, Li+, K+, and NH4+ but not in those containing NMDG+ (Fig. 7A), indicating that Slc4a11A is a Na+-independent boric acid transporter. Fig. 7B shows that 20 mM boric acid elicited whole-cell currents (Vh = +60 mV) in Slc4a11A oocytes in the presence of 0, 40, 80, or 96 mM NMDG, suggesting that the inhibition was observed only when NMDG was present at high concentrations, and the estimated IC50 value of NMDG in this condition was ∼67 mM.
      Figure thumbnail gr7
      Figure 7Voltage-clamp analyses of Na+-independent electrogenic boric acid transport activity of Slc4a11A. (A) I-V relationships of Slc4a11A or water-injected (control) oocytes in a solution containing 20 mM boric acid and various cations. Boric acid-elicited currents calculated by subtraction are shown. n = 3–6. (B) Dose-dependent inhibition of boric acid transport activity of Slc4a11A by NMDG. Boric acid-elicited currents of Slc4a11A oocytes (holding potential Vh: +60 mV) in the presence of various concentrations of NMDG are shown. Values are means ± SD. n = 4–10.
      Boric acid transport in Na+-free media was also confirmed by the marked increase in pHi (Fig. 8A). Similar experiments were not performed with NH4+ because exposure to NH4+ alters pHi and increases the buffering power of oocytes (
      • Boron W.F.
      • De Weer P.
      Intracellular pH transients in squid giant axons caused by CO2, NH3, and metabolic inhibitors.
      ). Control oocytes did not show significant pHi changes (Fig. 8B). The [Na+]i of Slc4a11A oocytes did not change in solutions containing 20 mM boric acid (Fig. 8C). These results confirmed that Slc4a11A is a Na+-independent electrogenic boric acid transporter.
      Figure thumbnail gr8
      Figure 8Ion-selective microelectrode analysis during Vm clamping and pH dependence of Na+-independent electrogenic boric acid transport activity of Slc4a11A. Representative traces of boric acid-elicited currents (holding potential Vh: −60 or 0 mV) and changes in intracellular pH of Slc4a11A (A) and control (B) oocytes. Oocytes were analyzed in ND96 (indicated by Na+) or similar media in which Na+ was replaced with Li+, Choline, or K+. (C) Representative traces of boric acid-elicited currents (holding potential, −20 mV) and intracellular [Na+] of Slc4a11A oocyte. (D) I-V relationship of 5 mM boric acid-elicited currents in various pH conditions. Values are means. n = 4–5.
      The ratio between the number for the net electric charge movement and that for the increased boron content was 1.1 (Table 1). To analyze the extracellular pH dependence of Slc4a11A activity, I–V relationships of Slc4a11A oocytes were analyzed in media containing 5 mM boric acid at pH levels of 6.5, 7.5, and 8.5 (Fig. 8D). The boric acid-elicited currents of Slc4a11A oocytes increased when the extracellular pH was increased. It is not clear whether this effect is due to the reduction of extracellular H+ (increase in extracellular OH) or the altered equilibrium of boric acid, which increases the concentration of extracellular B(OH)4. Taken together, these results indicate that Slc4a11A is a B(OH)4 uniporter, B(OH)3-OH cotransporter, or B(OH)3/H+ exchanger.
      Table 1Comparison of electric charge movement and boron content of Slc4a11A oocyte incubated in medium containing 10 mM boric acid at Vh of 0 mV for 10 min
      Average ± SE
      Electric charge movement (Etotal)249 ± 17 μC
      Electric charge movement by leak current (Eleak)95 μC
      Net electric charge movement (Eboric acid)152 ± 15 μC
      Number of net electric charge movements (A)9.5 ± 0.9 × 1020
      Boron content1.77 ± 0.1 nmol
      Boron content before incubation in medium containing boric acid0.21 nmol
      Increased boron content1.56 ± 0.1 nmol
      Number of increased boron contents (B)9.0 ± 0.6 × 1020
      Ratio (A/B)1.1
      Correlation coefficient0.90
      N5
      P0.039
      To confirm whether the Na+-independent nature of Slc4a11A was specific to the Xenopus oocyte expression system, we measured the whole-cell currents of HEK293 cells expressing eGFP-tagged Slc4a11A (Fig. 9A). Iboric acid was observed in HEK293 cells expressing eGFP-Slc4a11A and in Na+-free medium containing choline but not in that containing NMDG.
      Figure thumbnail gr9
      Figure 9Activity of Slc4a11A in HEK293 and yeast cells. (A) The whole-cell current was measured in untransfected HEK293 cells (control) or HEK293 cells expressing EGFP-Slc4a11A. The cells were incubated in a solution containing 20 mM boric acid and 145 mM Na+, or Na+-free media in which all Na+ was replaced with choline or NMDG. (B) Concentration of boron in the yeast cells expressing Slc4a11s or AtBOR1. Cells were incubated in a medium containing 20 mM boric acid; boron concentration in these cells was measured by ICP-MS. Dots represent individual data. Values are means ± SD. *P < 0.002.
      Yeast was used to compare the function of pufferfish Slc4a11A with that of the plant boron efflux transporter BOR1. A transformant of the Saccharomyces cerevisiae strain Y01169 carrying the yeast expression plasmid pYES-Slc4a11A was prepared, and its boron excretion was compared with that of the control strain lacking the endogenous boron transporter gene bor1p. When incubated with 20 mM boric acid, the transformant accumulated significantly lower levels of intracellular boron (P < 0.002, n = 4), which were similar to those of a BOR1 transformant (
      • Takano J.
      • Noguchi K.
      • Yasumori M.
      • Kobayashi M.
      • Gajdos Z.
      • Miwa K.
      • Hayashi H.
      • Yoneyama T.
      • Fujiwara T.
      Arabidopsis boron transporter for xylem loading.
      ) (Fig. 9B). This result indicates that Slc4a11A can export boric acid against a concentration gradient.

      Discussion

      In this study, we found that pufferfish in SW, but not in FW or BW, excreted boric acid into their urine at a high rate. In other words, boric acid is a major component of marine fish urine. SW-acclimated river pufferfish contain high [boric acid]urine while rectal fluid [boric acid] is quite low, demonstrating that the boric acid ingested from SW is absorbed by the gut and excreted by the kidney. The [boric acid]urine of pufferfish in SW was 30–40 times greater than that of [boric acid]SW. This level of [boric acid]urine is sufficient to account for the amount of SW-ingested boric acid, suggesting that the major route of boric acid excretion is through the urine.
      Database mining and expression analyses, including in situ hybridization analyses, have shown that the major paralogs expressed in the renal tubules of river pufferfish are Slc4a11A. Moreover, Slc4a11A expression is upregulated in the kidney after SW acclimation, and the Slc4a11A protein is localized at the apical membrane of renal tubules, suggesting its crucial role in urine production during SW acclimation.
      In humans, SLC4A11 was initially characterized as a Na+-coupled borate cotransporter (
      • Park M.
      • Li Q.
      • Shcheynikov N.
      • Zeng W.
      • Muallem S.
      NaBC1 is a ubiquitous electrogenic Na+ -coupled borate transporter essential for cellular boron homeostasis and cell growth and proliferation.
      ); however, subsequent studies revealed that human SLC4A11 and mouse Slc4a11 mediate H+ (OH) conductance, but do not transport B(OH)4 or HCO3 (
      • Jalimarada S.S.
      • Ogando D.G.
      • Vithana E.N.
      • Bonanno J.A.
      Ion Transport Function of SLC4A11 in Corneal Endothelium.
      ,
      • Kao L.
      • Azimov R.
      • Abuladze N.
      • Newman D.
      • Kurtz I.
      Human SLC4A11-C functions as a DIDS-stimulatable H+(OH-) permeation pathway: partial correction of R109H mutant transport.
      ,
      • Kao L.
      • Azimov R.
      • Shao X.M.
      • Frausto R.F.
      • Abuladze N.
      • Newman D.
      • Aldave A.J.
      • Kurtz I.
      Multifunctional ion transport properties of human SLC4A11: comparison of the SLC4A11-B and SLC4A11-C variants.
      ,
      • Kao L.
      • Azimov R.
      • Shao X.M.
      • Abuladze N.
      • Newman D.
      • Zhekova H.
      • Noskov S.
      • Pushkin A.
      • Kurtz I.
      SLC4A11 function: evidence for H+ (OH-) and NH3-H+ transport.
      ,
      • Loganathan S.K.
      • Schneider H.P.
      • Morgan P.E.
      • Deitmer J.W.
      • Casey J.R.
      Functional assessment of SLC4A11, an integral membrane protein mutated in corneal dystrophies.
      ,
      • Myers E.J.
      • Marshall A.
      • Jennings M.L.
      • Parker M.D.
      Mouse Slc4a11 expressed in Xenopus oocytes is an ideally selective H+/OH- conductance pathway that is stimulated by rises in intracellular and extracellular pH.
      ,
      • Ogando D.G.
      • Jalimarada S.S.
      • Zhang W.
      • Vithana E.N.
      • Bonanno J.A.
      SLC4A11 is an EIPA-sensitive Na+ permeable pHi regulator.
      ,
      • Quade B.N.
      • Marshall A.
      • Parker M.D.
      pH dependence of the Slc4a11-mediated H(+) conductance is influenced by intracellular lysine residues and modified by disease-linked mutations.
      ). In contrast to these studies on mammalian Slc4a11, we showed here that a fish paralog of Slc4a11, Slc4a11A, acts as an electrogenic boric acid transporter based on the following evidence:1) dose-dependent boric acid elicited whole-cell currents (Iboric acid) in Xenopus oocytes expressing Slc4a11A; 2) boric acid elicited a marked increase in pHi in Xenopus oocytes expressing Slc4a11A; and 3) boric acid altered the intracellular boron content in Xenopus oocytes and a yeast strain expressing Slc4a11A. The difference in activity of Slc4a11 between mammals and marine teleosts raises a new question as to how Slc4a11 function evolved in vertebrate animals. Further studies on the activities of Slc4a11 orthologs and paralogs of various vertebrate species will clarify whether mammalian Slc4a11 lost boric acid transport activity or SW fish Slc4a11A acquired boric acid transport activity during the history of vertebrate evolution. In addition, further detailed studies on the activities of pufferfish Slc4a11A and -B will clarify if pufferfish Slc4a11 paralogs have activity similar to that of mammalian Slc4a11 and if pufferfish Slc4a11A has activity other than electrogenic boric acid transport activity.
      Electrophysiological experiments have demonstrated that Slc4a11A is an electrogenic boric acid transporter that is independent of Na+. Table 1 illustrates one anion influx or one cation efflux coupling to the influx of one boric acid molecule, indicating that Slc4a11A should be a B(OH)4 uniporter, B(OH)3-OH cotransporter, or B(OH)3/H+ exchanger (Fig. 10A). These modes of action, in which negative membrane potential is the driving force, are advantageous for boric acid secretion against a concentration gradient, and provide a thermodynamically favorable mechanism for the cellular efflux of boric acid. BOR1 is an efflux transporter in plants and yeast. Accordingly, BOR1 and Slc4a11A exhibit reduced [B]i when expressed in yeast cells, suggesting that Slc4a11A (fish) and BOR1 (plants and yeast) secrete boric acid via a common mechanism.
      Figure thumbnail gr10
      Figure 10Model of electrogenic boric acid transport activity of Slc4a11A. (A) Schematic representation of B(OH)4 uniporter (left) or B(OH)3-OH cotransporter (right) activity of Slc4a11A in Xenopus oocytes. B(OH)3/H+ exchange activity is equivalent with B(OH)3-OH cotransport activity (B) Hypothetical model of the epithelial secretion system for boric acid in the collecting duct cell of SW fish. Apical Slc4a11A mediates the B(OH)4 uniport (left) or B(OH)3-OH cotransport (right), and the negative membrane potential and acidic pH of urine may be the driving forces for the luminal boric acid secretion. The activity of Slc4a11A may be coupled with apical H+-efflux systems, such as the Na+/H+ exchanger 3 (NHE3) or V-type H+-ATPase. Basolateral entry of boric acid from the plasma to the cytoplasm may be mediated by AQPs.
      The movement of boric acid through B(OH)4 uniporter, B(OH)3-OH cotransporter, or B(OH)3/H+ exchanger will be determined by the following 1)–3) equations, respectively, when the stoichiometry of B(OH)3-OH cotransporter or B(OH)3/H+ exchanger are assumed to be 1 : 1,
      1) ΔμB(OH)4=RTln([B(OH)4]i[B(OH)4]o)+(1)FΔΨ
      2) ΔμB(OH)3OH=ΔμB(OH)3+ΔμOH=RTln([B(OH)3]i[B(OH)3]o)+RTln([OH]i[OH]o)+(1)FΔΨ=RTln([B(OH)3]i[OH]i[B(OH)3]o[OH]o)+(1)FΔΨ
      3) ΔμB(OH)3/H+=ΔμB(OH)3ΔμH+=RTln([B(OH)3]i[B(OH)3]o){RTln([H+]i[H+]o)+(+1)FΔΨ}=RTln([B(OH)3]i[H+]o[B(OH)3]o[H+]i)(+1)FΔΨwhere R is the gas constant, T is the absolute temperature, F is the Faraday constant, ln is the natural log, ΔΨ is the potential difference, and Δμsolute is the electrochemical potential difference (Joules/mole). The dissociation constants of boric acid (Ka) and water (Kw) are:
      Ka=[B(OH)4][H+][B(OH)3]


      Kw=[H+][OH]


      Therefore, the following equations hold:
      [B(OH)4]i[B(OH)4]o=[B(OH)3]i[OH]i[B(OH)3]o[OH]o=[B(OH)3]i[H+]o[B(OH)3]o[H+]i


      ΔμB(OH)4=ΔμB(OH)3OH=ΔμB(OH)3/H+


      When unclamped oocytes expressing Slc4a11A is incubated in ND96 solution containing 20 mM boric acid ([boric acid]o = 20 mM) for several minutes, the whole boric acid content of is assumed to be ∼0.1 nmol from Fig. 6H. Whole oocyte volume is ∼0.7 μL, and when the volume of cytoplasm is assumed to be ∼10% of whole cell volume (
      • Kikkawa M.
      • Takano K.
      • Shinagawa A.
      Location and behavior of dorsal determinants during first cell cycle in Xenopus eggs.
      ) [boric acid]i can be calculated as ∼1.4 mM. pHo is 7.5 and pHi can be assumed to be ∼7.1. In these assumptions, using pKa value of boric acid, 9.24, [B(OH)3]o, [B(OH)4]o, [B(OH)3]i, and [B(OH)4]i can be calculated as 19.6, 0.4, 1.39, and 0.01, respectively, and the ratio are calculated as:
      [B(OH)4]i[B(OH)4]o=[B(OH)3]i[OH]i[B(OH)3]o[OH]o=[B(OH)3]i[H+]o[B(OH)3]o[H+]i=0.03


      The potential difference ΔΨ equivalent to this concentration difference is −89 mV at 18°C. Therefore, this concentration difference is consistent with the hyperpolarization of −85 mV in Slc4a11A oocytes exposed to 20 mM boric acid solution when Slc4a11A acts as B(OH)4 uniporter, B(OH)3-OH cotransporter, or B(OH)3/H+ exchanger.
      Recently, we analyzed the boric acid transport activity of human aquaporins and showed that AQP3, 7, 8, 9, and 10 act as boric acid transport systems, likely as B(OH)3 channels, based on the following evidence:1) boric acid elicited a marked “decrease” in pHi but did not elicit a change in membrane potential in Xenopus oocytes expressing these AQPs; and 2) boric acid altered intracellular boron content in Xenopus oocytes expressing these AQPs (
      • Ushio K.
      • Watanabe E.
      • Kamiya T.
      • Nagashima A.
      • Furuta T.
      • Imaizumi G.
      • Fujiwara T.
      • Romero M.F.
      • Kato A.
      Boric acid transport activity of human aquaporins expressed in Xenopus oocytes.
      ). The results showed that the B(OH)3 transport activities of AQP3, 7, 8, 9, and 10 are electroneutral, suitable for the facilitated diffusion of B(OH)3 across the plasma membrane, and contrast with the electrogenic boric acid transport activity of Slc4a11A.
      The resulting model for boric acid secretion in the kidneys of SW fish is shown in Fig. 10B. In SW river pufferfish, the urine/plasma ratio of boric acid is ∼330; therefore, the kidney tubules secrete boric acid against the concentration gradient. We hypothesized how the apical electrogenic boric acid transporter Slc4a11A secretes boric acid into the urine and how the renal tubule concentrates boric acid. The negative membrane potential of renal tubular epithelial cells and the acidic pH of the urine of SW fish may induce the Slc4a11A-mediated boric acid secretion. Slc4A11A-mediated boric acid influx elicits a positive outward current, whereas Slc4A11A-mediated boric acid efflux elicits a negative outward current. Therefore, a negative membrane potential is beneficial for boric acid efflux from cells. Marine teleosts excrete acidic urine with a pH of 5.7–6.6 (
      • Maren T.H.
      • Fine A.
      • Swenson E.R.
      • Rothman D.
      Renal acid-base physiology in marine teleost, the long-horned sculpin (Myoxocephalus octodecimspinosus).
      ). If Slc4a11A is a B(OH)3-OH cotransporter or B(OH)3/H+ exchanger, the acidic pH of urine directly stimulates Slc4A11A-mediated boric acid efflux. Furthermore, if Slc4a11A is a B(OH)4 uniporter, the acidic pH of urine is also beneficial for boric acid efflux, because secreted B(OH)4 is converted to B(OH)3 by equilibrium in acidic urine and stimulates B(OH)4 efflux by the B(OH)4 uniporter. Two preconditions are necessary for this secretory model: (i) the basolateral membrane expresses the B(OH)3 permeable member of the aquaporin family that mediates the basolateral supply of boric acid for luminal secretion; and (ii) the apical membrane does not express the B(OH)3 permeable member of the aquaporin family that can break the boric acid gradient across the apical membrane. Further analyses are required to determine the expression and intracellular localization of B(OH)3 permeable aquaporin(s) in the kidney tubules of SW fish.

      Experimental Procedures

      Animals

      Euryhaline pufferfish (river pufferfish, mefugu, Takifugu obscurus) were purchased from local dealers in 2003 and 2011 and reared in tanks containing brackish water (BW, 3–14% diluted SW) (
      • Kato A.
      • Doi H.
      • Nakada T.
      • Sakai H.
      • Hirose S.
      Takifugu obscurus is a euryhaline fugu species very close to Takifugu rubripes and suitable for studying osmoregulation.
      ,
      • Kato A.
      • Chang M.H.
      • Kurita Y.
      • Nakada T.
      • Ogoshi M.
      • Nakazato T.
      • Doi H.
      • Hirose S.
      • Romero M.F.
      Identification of renal transporters involved in sulfate excretion in marine teleost fish.
      ). They were transferred to FW tanks for 8–9 d (FW mefugu) and then to natural SW tanks for 8–9 d (SW mefugu). Marine pufferfish (tiger pufferfish, torafugu, Takifugu rubripes) were purchased from a local dealer, reared in natural SW (
      • Kato A.
      • Doi H.
      • Nakada T.
      • Sakai H.
      • Hirose S.
      Takifugu obscurus is a euryhaline fugu species very close to Takifugu rubripes and suitable for studying osmoregulation.
      ,
      • Kato A.
      • Chang M.H.
      • Kurita Y.
      • Nakada T.
      • Ogoshi M.
      • Nakazato T.
      • Doi H.
      • Hirose S.
      • Romero M.F.
      Identification of renal transporters involved in sulfate excretion in marine teleost fish.
      ), and then transferred to 150-L tanks containing BW (14% diluted SW) for 8–9 d (BW torafugu). The experimental animals were anesthetized by immersion in 0.1% ethyl m-aminobenzoate (MS-222; tricaine) neutralized with sodium bicarbonate. After humane killing by cervical transection, blood and urine were collected from the hepatic vein and urinary bladder, respectively, and the tissues were dissected. The animal protocols and procedures were approved by the Institutional Animal Care and Use Committee of Tokyo Institute of Technology (pufferfish and Xenopus) and Mayo Clinic (Xenopus).

      Quantitative determination of boron concentration by inductively-coupled plasma mass spectrometry (ICP-MS).

      Fish sera (200 μL), dried Xenopus oocytes, or dried yeast cells were digested with concentrated nitric acid in Teflon tubes (
      • Takano J.
      • Kobayashi M.
      • Noda Y.
      • Fujiwara T.
      Saccharomyces cerevisiae Bor1p is a boron exporter and a key determinant of boron tolerance.
      ), and the residues were dissolved in 0.08 M nitric acid containing 5 μg/L Be. Concentrations of 10B and 11B were measured by ICP-MS (Seiko Instruments, Tokyo, Japan) using Be as an internal standard, and the sum of the 10B and 11B concentrations was presented as the B concentration (
      • Takano J.
      • Noguchi K.
      • Yasumori M.
      • Kobayashi M.
      • Gajdos Z.
      • Miwa K.
      • Hayashi H.
      • Yoneyama T.
      • Fujiwara T.
      Arabidopsis boron transporter for xylem loading.
      ).

      Quantitative determination of boric acid concentrations using azomethine-H.

      Boric acid levels in urine, rectal fluid, and natural SW were determined using the azomethine-H method (
      • Zenki M.
      • Nose K.
      • Toei K.
      Spectrophotometric Determination of Boron with an Azomethine H-Derivative.
      ). Each sample (20 μL) was mixed with 40 μL of azomethine-H solution (10 mM azomethine-H and 57 mM L-ascorbic acid) and 40 μL of buffer-masking solution (6.5 mM ammonium acetate, 29 mM EDTA, 4.2 mM, acetic acid, and 1.0 mM thioglycolic acid), incubated at 20°C for 30 min, and measured for absorbance at 410 nm.

      Molecular cloning.

      Full-length cDNAs for Slc4a11A (GenBank: AB534190) and Slc4a11B (AB534191) were obtained by rapid amplification of cDNA ends (RACE) (
      • Kurita Y.
      • Nakada T.
      • Kato A.
      • Doi H.
      • Mistry A.C.
      • Chang M.H.
      • Romero M.F.
      • Hirose S.
      Identification of intestinal bicarbonate transporters involved in formation of carbonate precipitates to stimulate water absorption in marine teleost fish.
      ) from the kidneys of SW-acclimated mefugu using the primers shown in Table 2.
      Table 2List of primers used for PCR amplification.
      GeneSequenceRemark
      Slc4a11AGGAGGAGGGCCGCGAGAGCTGCInitial cloning (S)
      ACTTCAGCAGGCAACGATCTTTCInitial cloning (AS)
      AAGTCCTTTCCTCCTGCGTCTGT5ʹ RACE outer
      TCGCGGCCCTCCTCCAGCAGGTG5ʹ RACE inner
      CACTTCTTCACAGGAGTGCAGATG3ʹ RACE outer
      ACATCATGGATGCCCAACATATG3ʹ RACE inner
      ACGAATGGATATGCTTTCGCAGGORF cloning (S)
      GCTCTGTAGTTACATATGTTGGGCORF cloning (AS)
      CCTCTGTGCGTTTGGGATGTRT-PCR (S)
      GCGTCGATCATTTTAGGAAGCAGRT-PCR (AS)
      CCTCTGTGCGTTTGGGATGTReal-time PCR (S)
      GCGTCGATCATTTTAGGAAGCAGReal-time PCR (AS)
      ATGGATATGCTTTCGCAGCDS cloning (S)
      GCTCTGTAGTTACATATGTTGGGCCDS cloning (AS)
      Slc4a11BGGAGACGACATCCACCTTTACGInitial cloning (S)
      GGCAGCCGGCGGCACAGGTCCTCInitial cloning (AS)
      AGCCACGACTGCTGGTACTG5ʹ RACE outer
      TTCACATACTTCCGCGATGTGTT5ʹ RACE inner
      TCACCTTCCTGCAGATGATGCAGC3ʹ RACE outer
      GAGAGAGAGAAAGAGAAAAAGT3ʹ RACE inner
      CACTCATCAGCACAGGATAACAORF cloning (S)
      TGATGACTGGACTGGGAGAACCORF cloning (AS)
      AGTGCCCCAGAGAAAGATCCRT-PCR (S)
      ATGATGTGAGGAAGCACGTTGRT-PCR (AS)
      AGTGCCCCAGAGAAAGATCCReal-time PCR (S)
      ATGATGTGAGGAAGCACGTTGReal-time PCR (AS)
      β-actinGCAAAACACCACACATTTCTCATACRT-PCR (S)
      ATGCCAATGAGTTGGTCGTCTART-PCR (AS)
      GAPDHGGCCCAATGAAAGGCATTCTReal-time PCR (S)
      TGGGTGTCGCCGTTGAAReal-time PCR (AS)
      S, sense primer; AS, antisense primer.

      Semiquantitative reverse transcription (RT)-PCR and Real-time PCR.

      Semi-quantitative RT-PCR was performed using total RNAs isolated from the tissues and the primers shown in Table 2 as described previously (
      • Kato A.
      • Chang M.H.
      • Kurita Y.
      • Nakada T.
      • Ogoshi M.
      • Nakazato T.
      • Doi H.
      • Hirose S.
      • Romero M.F.
      Identification of renal transporters involved in sulfate excretion in marine teleost fish.
      ,
      • Kurita Y.
      • Nakada T.
      • Kato A.
      • Doi H.
      • Mistry A.C.
      • Chang M.H.
      • Romero M.F.
      • Hirose S.
      Identification of intestinal bicarbonate transporters involved in formation of carbonate precipitates to stimulate water absorption in marine teleost fish.
      ,
      • Islam Z.
      • Kato A.
      • Romero M.F.
      • Hirose S.
      Identification and apical membrane localization of an electrogenic Na+/Ca2+ exchanger NCX2a likely to be involved in renal Ca2+ excretion by seawater fish.
      ). The relative renal expression of Slc4a11A and Slc4a11B was quantified by real-time PCR using the SYBR Green method, with GAPDH as a reference gene (
      • Kato A.
      • Chang M.H.
      • Kurita Y.
      • Nakada T.
      • Ogoshi M.
      • Nakazato T.
      • Doi H.
      • Hirose S.
      • Romero M.F.
      Identification of renal transporters involved in sulfate excretion in marine teleost fish.
      ,
      • Kato A.
      • Muro T.
      • Kimura Y.
      • Li S.
      • Islam Z.
      • Ogoshi M.
      • Doi H.
      • Hirose S.
      Differential expression of Na+-Cl- cotransporter and Na+-K+-Cl- cotransporter 2 in the distal nephrons of euryhaline and seawater pufferfishes.
      ). Significant differences at P < 0.05 were determined by a two-sample Student’s t-test, assuming equal variance. Reproducibility was confirmed using two sets of experiments.

      Antibody production and absorption.

      Polyclonal antisera against Slc4a11s were generated by immunizing rabbits with a keyhole limpet hemocyanin (KLH)-conjugated peptide based on the C-terminus of Slc4a11A (PKMIDAKYLDIMDAQHM) (Operon Biotechnologies, Tokyo, Japan). The antiserum (20 μL, 1:50 dilution) was absorbed with KLH (20 μg) in the presence or absence of 27 μg of antigen peptide for 16 h at 4°C and then for 2 h at 20°C with continuous mixing.

      Expression of Slc4a11A and Slc4a11B in HEK293 and MDCK cells.

      Full-length cDNAs for Slc4a11A and -B were subcloned into the pcDNA3 vector (Invitrogen). HEK293 and MDCK cells were transfected with pcDNA3-Slc4a11A, pcDNA3-Slc4a11B, or an empty vector using FuGENE6 (Roche), according to the manufacturer’s protocol. The cells were fixed, stained with antiserum, preimmune serum, or antigen-absorbed antiserum (1:1,000 dilution), and then with the fluorescence-labeled secondary antibodies, phalloidin TRITC, and Hoechst 33342, as described previously (
      • Kato A.
      • Muro T.
      • Kimura Y.
      • Li S.
      • Islam Z.
      • Ogoshi M.
      • Doi H.
      • Hirose S.
      Differential expression of Na+-Cl- cotransporter and Na+-K+-Cl- cotransporter 2 in the distal nephrons of euryhaline and seawater pufferfishes.
      ). In the MDCK cells, anti ZO-1 (zona occludens 1) mouse monoclonal antibody (1:200, clone ZO1-1A12) was used to visualize tight junctions. Images were obtained with a confocal microscope (TCS-SPE; Leica, Wetzlar, Germany) using the LAS AF software (Leica).

      Western blot analyses.

      Membrane fractions were collected as described previously (
      • Islam Z.
      • Kato A.
      • Romero M.F.
      • Hirose S.
      Identification and apical membrane localization of an electrogenic Na+/Ca2+ exchanger NCX2a likely to be involved in renal Ca2+ excretion by seawater fish.
      ,
      • Nawata C.M.
      • Hirose S.
      • Nakada T.
      • Wood C.M.
      • Kato A.
      Rh glycoprotein expression is modulated in pufferfish (Takifugu rubripes) during high environmental ammonia exposure.
      ). Denatured protein samples were deglycosylated prior to blotting using a mixture of glycosidases (peptide-N-glycosidase and endo-α-N-acetylgalactosaminidase), according to the manufacturer’s instructions. The membrane proteins (1 μg) incubated with or without glycosidases were analyzed by western blotting with anti-Slc4a11 antiserum or antigen-absorbed antiserum (1:10,000), as described previously (
      • Islam Z.
      • Kato A.
      • Romero M.F.
      • Hirose S.
      Identification and apical membrane localization of an electrogenic Na+/Ca2+ exchanger NCX2a likely to be involved in renal Ca2+ excretion by seawater fish.
      ,
      • Nawata C.M.
      • Hirose S.
      • Nakada T.
      • Wood C.M.
      • Kato A.
      Rh glycoprotein expression is modulated in pufferfish (Takifugu rubripes) during high environmental ammonia exposure.
      ).

      Immunohistochemistry.

      The kidneys from SW mefugu were fixed and frozen in an optimum cutting temperature compound (Sakura Finetek, Tokyo, Japan). Sections (6 μm) were stained with the KLH-absorbed anti-Slc4a11 rabbit antiserum (1:20 dilution), anti-eel Na+-K+-ATPase rat antiserum, and fluorescence-labeled phalloidin as described previously (
      • Kato A.
      • Muro T.
      • Kimura Y.
      • Li S.
      • Islam Z.
      • Ogoshi M.
      • Doi H.
      • Hirose S.
      Differential expression of Na+-Cl- cotransporter and Na+-K+-Cl- cotransporter 2 in the distal nephrons of euryhaline and seawater pufferfishes.
      ). Fluorescence was detected as described above.

      In situ hybridization.

      A 644-bp fragment of Slc4a11A cDNA (nucleotides 1028–1671) and a 240-bp fragment of Slc4a11B cDNA (nucleotides 1–240) were used to prepare digoxigenin (DIG)-labeled sense and antisense riboprobes. Paraffin sections (4 μm) of the SW mefugu kidney were hybridized with the riboprobes that were visualized using alkaline phosphatase-conjugated anti-DIG antibodies and nitro blue tetrazolium/bromochloroindolyl phosphate substrates. Kernechtrot was used for nuclear counterstaining.

      Expression of Slc4a11A in Xenopus oocytes.

      Full-length cDNA for Slc4a11A was subcloned into a pGEMHE Xenopus expression vector and used for cRNA synthesis (
      • Kurita Y.
      • Nakada T.
      • Kato A.
      • Doi H.
      • Mistry A.C.
      • Chang M.H.
      • Romero M.F.
      • Hirose S.
      Identification of intestinal bicarbonate transporters involved in formation of carbonate precipitates to stimulate water absorption in marine teleost fish.
      ,
      • Liman E.R.
      • Tytgat J.
      • Hess P.
      Subunit stoichiometry of a mammalian K+ channel determined by construction of multimeric cDNAs.
      ,
      • Xie Q.
      • Welch R.
      • Mercado A.
      • Romero M.F.
      • Mount D.B.
      Molecular characterization of the murine Slc26a6 anion exchanger: functional comparison with Slc26a1.
      ). X. laevis oocytes were dissociated with collagenase (
      • Romero M.F.
      • Fong P.
      • Berger U.V.
      • Hediger M.A.
      • Boron W.F.
      Cloning and functional expression of rNBC, an electrogenic Na+-HCO3- cotransporter from rat kidney.
      ) and injected with 50 nL of water or a solution containing cRNA at 0.5 μg/μL (25 ng/oocyte). Oocytes were incubated at 16°C in OR3 media (
      • Romero M.F.
      • Fong P.
      • Berger U.V.
      • Hediger M.A.
      • Boron W.F.
      Cloning and functional expression of rNBC, an electrogenic Na+-HCO3- cotransporter from rat kidney.
      ) and studied 3–6 d after injection.

      Two-electrode voltage clamp analyses of Xenopus oocytes.

      Currents of oocytes were recorded as described previously at 18°C (
      • Romero M.F.
      • Fong P.
      • Berger U.V.
      • Hediger M.A.
      • Boron W.F.
      Cloning and functional expression of rNBC, an electrogenic Na+-HCO3- cotransporter from rat kidney.
      ). ND96 (96 mM NaCl, 2 mM KCl, 1 mM MgCl2, 1.8 mM CaCl2, and 5 mM HEPES, pH 7.5, ∼200 mosmol/kg) was used as the standard saline solution, and 70Cl-ND96 (ND96 containing 70 mM Cl) was used as the standard bath solution (
      • Kato A.
      • Chang M.H.
      • Kurita Y.
      • Nakada T.
      • Ogoshi M.
      • Nakazato T.
      • Doi H.
      • Hirose S.
      • Romero M.F.
      Identification of renal transporters involved in sulfate excretion in marine teleost fish.
      ,
      • Kurita Y.
      • Nakada T.
      • Kato A.
      • Doi H.
      • Mistry A.C.
      • Chang M.H.
      • Romero M.F.
      • Hirose S.
      Identification of intestinal bicarbonate transporters involved in formation of carbonate precipitates to stimulate water absorption in marine teleost fish.
      ). To prepare 70Cl-ND96 containing 33 mM boric acid, NaCl (33 mM) was replaced with boric acid (33 mM), and the solution was titrated to pH 7.5 using NaOH. Test solutions with different boric acid concentrations were prepared by mixing 70Cl-ND96 with 70Cl-ND96 containing 33 mM boric acid followed by titration to pH 7.5. Boric acid-elicited currents were calculated as I(boric acid)-I(no boric acid). The oocyte currents were recorded with an OC-725C voltage clamp (Warner Instruments, Hamden, CT, USA) and Pulse software (HEKA, Lambrecht, Germany) as previously described (
      • Dinour D.
      • Chang M.H.
      • Satoh J.
      • Smith B.L.
      • Angle N.
      • Knecht A.
      • Serban I.
      • Holtzman E.J.
      • Romero M.F.
      A novel missense mutation in the sodium bicarbonate cotransporter (NBCe1/SLC4A4) causes proximal tubular acidosis and glaucoma through ion transport defects.
      ). The oocytes were clamped at a holding potential (Vh) of −60 mV, and the current was constantly monitored and recorded at 1 Hz. The I−V protocols consisted of 200-ms steps from Vh in 20 mV steps between −160 and +60 mV. Data are expressed as the means ± SEM.
      In 0-Na+ solutions, Na+ was replaced by choline, N-methyl-D-glucamine (NMDG), K+, NH4+, or Li+ (
      • Sciortino C.M.
      • Romero M.F.
      Cation and voltage dependence of rat kidney electrogenic Na+-HCO3- cotransporter, rkNBC, expressed in oocytes.
      ). To analyze the effect of NMDG on boric acid-elicited currents, 40, 80, and 96 mM Na+ of ND96 containing 20 mM boric acid were replaced with equal concentrations of NMDG. The 50% inhibitory concentration (IC50) was calculated with GraphPad Prism software. To analyze the effect of pH, the ND96 solution and that containing 5 mM boric acid were titrated to a pH of 6.5 and 7.5 using HCl and NaOH, respectively.

      Ion-selective microelectrode analysis of Xenopus oocytes.

      pHi or [Na+]I was measured as the difference between the pH or Na+ electrode and a KCl voltage electrode impaled into the oocyte, and the membrane potential (Vm) was measured as the difference between the KCl microelectrode and an extracellular calomel at 18°C (
      • Romero M.F.
      • Fong P.
      • Berger U.V.
      • Hediger M.A.
      • Boron W.F.
      Cloning and functional expression of rNBC, an electrogenic Na+-HCO3- cotransporter from rat kidney.
      ). pH electrodes were calibrated using pH 6.0 and 8.0 buffer (pH) or 100 and 10 mM NaCl (Na+), followed by point calibration in ND96 (pH 7.50 or 96 mM) as described previously (
      • Romero M.F.
      • Fong P.
      • Berger U.V.
      • Hediger M.A.
      • Boron W.F.
      Cloning and functional expression of rNBC, an electrogenic Na+-HCO3- cotransporter from rat kidney.
      ).
      The ion-selective microelectrode analysis during Vm clamping was performed as previously described (
      • Chang M.H.
      • Plata C.
      • Kurita Y.
      • Kato A.
      • Hirose S.
      • Romero M.F.
      Euryhaline pufferfish NBCe1 differs from nonmarine species NBCe1 physiology.
      ). One ion-selective electrode and two KCl electrodes were inserted into the oocyte, and the oocytes were clamped to a Vh of −60 or 0 mV in ND96 or 70Cl-ND96 solution after Vm and pHi were stabilized. At steady state, the current and pHi were monitored in response to the change in bath solutions.

      Boric acid uptake and efflux by Xenopus oocytes.

      For the boric acid uptake experiment with a voltage clamp, oocytes were voltage-clamped at 0 mV and perfused with 70Cl-ND96 containing 10 mM boric acid for 10 min at 18°C. For the experiment without a voltage clamp, oocytes were placed in 70Cl-ND96 containing 20 mM boric acid for set periods at 18°C. For the boric acid efflux experiment without a voltage clamp, oocytes were placed in 70Cl-ND96 containing 20 mM boric acid for 24 h at 16°C and then in ND96 for set periods at 18°C. Each oocyte was washed with ND96 for several seconds and dried after the removal of the washing solution. The total boron content of each oocyte was quantified by ICP-MS, as described above.
      During the boric acid uptake experiment of oocytes using a voltage clamp, the current was recorded at 9 Hz and used to calculate the electrical charge movement (Etotal). The average leak current in 70Cl-ND96 was used to estimate the electrical charge movement using the leak current (Eleak). The net electric charge movement of the oocytes elicited by 10 mM boric acid (Eboric acid) was calculated by subtracting Eleak from Etotal. The number of net electric charge movements was calculated from the Eboric acid and elementary charge. The increase in boron content was calculated as the difference of the boron content before and after incubation in a medium containing boric acid. The increase in boron content was calculated using the Avogadro number. The ratio between the number of net electric charge movements and the number of increased boron content was calculated.

      Expression of Slc4a11A in HEK293 cells and measurement of its activity.

      Full-length cDNA for Slc4a11A was subcloned into a pEGFP-C vector, transiently transfected into HEK293 cells on poly L-lysine-coated coverslips using FuGene6, and incubated for 24–48 h in culture medium. Currents of HEK293 cells were recorded using a HEKA EPC 10+ patch-clamp amplifier. The standard bath solution contained 140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 10 mM HEPES, (pH 7.5 with NaOH), 10 mM glucose, and 1 mM CaCl2. Extracellular solutions containing 20 mM boric acid were prepared by substituting 20 mM NaCl with 20 mM boric acid (pH 7.5, using NaOH). Na+-free bath solutions were prepared by substituting 140 mM NaCl with 140 mM choline Cl (pH 7.5, using choline base) or 140 mM NMDG (pH 7.5, using HCl).

      Expression of Slc4a11A in yeast cells and measurement of its activity.

      Full-length cDNAs for Slc4a11A cDNA was subcloned into the pYES2 yeast expression vector (Invitrogen) and expressed in the Y01169 Saccharomyces cerevisiae strain as described previously (
      • Takano J.
      • Noguchi K.
      • Yasumori M.
      • Kobayashi M.
      • Gajdos Z.
      • Miwa K.
      • Hayashi H.
      • Yoneyama T.
      • Fujiwara T.
      Arabidopsis boron transporter for xylem loading.
      ). To measure boron concentration, cells in the mid-exponential phase were harvested, washed, and dried. The boron concentration was measured using ICP-MS, as described above.

      Statistical Analysis.

      Error bars represent SDs of the mean of at least three experiments. Statistical significance was calculated using an unpaired, two-sided Student’s t test. Statistical significance for more than two groups was analyzed by analysis of variance (one-way ANOVA) followed by the Tukey–Kramer multiple comparisons test (GraphPad Prism 5, GraphPad Software Inc., San Diego, CA, USA).

      Data availability

      The sequences reported in this paper are available at the GenBank database with accession numbers AB534190 and AB534191. Other data are contained in the article. All information is available from the corresponding author upon reasonable request.

      Conflict of interest

      The authors declare that they have no conflicts of interest with the contents of this article.

      Acknowledgments

      We thank Dr. Tsutomu Nakada for discussions; Shimpei Uraguchi, Youko Ohtsuka, Heather L Holmes, Elyse M. Scileppi, Dr. Islam Zinia, Dr. Shanshan Li, Naoko Hayashi, Noriko Isoyama, Yoko Yamamoto, Ayako Takada, Nana Shinohara, Natsue Yamamoto, Michiko Kotani, and the Open Research Facilities for Life Science and Technology, the Biomaterials Analysis Division, and Materials Analysis Division of the Tokyo Institute of Technology for technical assistance; and Yuriko Ishii for secretarial assistance.

      References

        • O'Neill M.A.
        • Eberhard S.
        • Albersheim P.
        • Darvill A.G.
        Requirement of borate cross-linking of cell wall rhamnogalacturonan II for Arabidopsis growth.
        Science. 2001; 294: 846-849
        • Fort D.J.
        • Rogers R.L.
        • McLaughlin D.W.
        • Sellers C.M.
        • Schlekat C.L.
        Impact of boron deficiency on Xenopus laevis: a summary of biological effects and potential biochemical roles.
        Biol. Trace Elem. Res. 2002; 90: 117-142
        • Rowe R.I.
        • Bouzan C.
        • Nabili S.
        • Eckhert C.D.
        The response of trout and zebrafish embryos to low and high boron concentrations is U-shaped.
        Biol. Trace Elem. Res. 1998; 66: 261-270
        • Nielsen F.H.
        Update on human health effects of boron.
        J. Trace Elem. Med. Biol. 2014; 28: 383-387
        • Uluisik I.
        • Karakaya H.C.
        • Koc A.
        The importance of boron in biological systems.
        J. Trace Elem. Med. Biol. 2018; 45: 156-162
        • Armstrong T.A.
        • Spears J.W.
        • Crenshaw T.D.
        • Nielsen F.H.
        Boron supplementation of a semipurified diet for weanling pigs improves feed efficiency and bone strength characteristics and alters plasma lipid metabolites.
        J. Nutr. 2000; 130: 2575-2581
        • Devirian T.A.
        • Volpe S.L.
        The physiological effects of dietary boron.
        Crit. Rev. Food Sci. Nutr. 2003; 43: 219-231
        • Park M.
        • Li Q.
        • Shcheynikov N.
        • Muallem S.
        • Zeng W.
        Borate transport and cell growth and proliferation. Not only in plants.
        Cell Cycle. 2005; 4: 24-26
        • Park M.
        • Li Q.
        • Shcheynikov N.
        • Zeng W.
        • Muallem S.
        NaBC1 is a ubiquitous electrogenic Na+ -coupled borate transporter essential for cellular boron homeostasis and cell growth and proliferation.
        Mol. Cell. 2004; 16: 331-341
        • Miwa K.
        • Takano J.
        • Omori H.
        • Seki M.
        • Shinozaki K.
        • Fujiwara T.
        Plants tolerant of high boron levels.
        Science. 2007; 318: 1417
        • Miwa K.
        • Fujiwara T.
        Boron transport in plants: co-ordinated regulation of transporters.
        Ann Bot. 2010; 105: 1103-1108
        • Khaliq H.
        • Juming Z.
        • Ke-Mei P.
        The Physiological Role of Boron on Health.
        Biol. Trace Elem. Res. 2018; 186: 31-51
      1. Nielsen, F. H. (1996) Boron. in Trace elements in human nutrition and health (World Health Organization, I. A. E. A. F. a. A. O. o. t. U. N. ed.), WHO, Geneva. pp 175-179

        • Howe P.D.
        A review of boron effects in the environment.
        Biol. Trace Elem. Res. 1998; 66: 153-166
        • Litovitz T.L.
        • Klein-Schwartz W.
        • Oderda G.M.
        • Schmitz B.F.
        Clinical manifestations of toxicity in a series of 784 boric acid ingestions.
        Am. J. Emerg. Med. 1988; 6: 209-213
        • Pfeiffer C.C.
        • Hallman L.F.
        • Gersh I.
        Boric acid ointment: a study of possible intoxication in the treatment of burns.
        JAMA. 1945; 128: 266-274
        • Weir Jr., R.J.
        • Fisher R.S.
        Toxicologic studies on borax and boric acid.
        Toxicol. Appl. Pharmacol. 1972; 23: 351-364
        • Schoderboeck L.
        • Muhlegger S.
        • Losert A.
        • Gausterer C.
        • Hornek R.
        Effects assessment: boron compounds in the aquatic environment.
        Chemosphere. 2011; 82: 483-487
      2. Eisler, R. (1990) Boron hazards to fish, wildlife, and invertebrates: A synoptic review, US Department of the Interior, Fish and Wildlife Service

      3. Birge, W., and Black, J. A. (1977) Sensitivity of vertebrate embryos to boron compounds.

        • Nakagawa Y.
        • Hanaoka H.
        • Kobayashi M.
        • Miyoshi K.
        • Miwa K.
        • Fujiwara T.
        Cell-type specificity of the expression of Os BOR1, a rice efflux boron transporter gene, is regulated in response to boron availability for efficient boron uptake and xylem loading.
        Plant Cell. 2007; 19: 2624-2635
        • Takano J.
        • Noguchi K.
        • Yasumori M.
        • Kobayashi M.
        • Gajdos Z.
        • Miwa K.
        • Hayashi H.
        • Yoneyama T.
        • Fujiwara T.
        Arabidopsis boron transporter for xylem loading.
        Nature. 2002; 420: 337-340
        • Takano J.
        • Wada M.
        • Ludewig U.
        • Schaaf G.
        • von Wiren N.
        • Fujiwara T.
        The Arabidopsis major intrinsic protein NIP5;1 is essential for efficient boron uptake and plant development under boron limitation.
        Plant Cell. 2006; 18: 1498-1509
        • Tanaka M.
        • Wallace I.S.
        • Takano J.
        • Roberts D.M.
        • Fujiwara T.
        NIP6;1 is a boric acid channel for preferential transport of boron to growing shoot tissues in Arabidopsis.
        Plant Cell. 2008; 20: 2860-2875
        • Romero M.F.
        • Chen A.P.
        • Parker M.D.
        • Boron W.F.
        The SLC4 family of bicarbonate (HCO3-) transporters.
        Mol. Aspects Med. 2013; 34: 159-182
        • Sutton T.
        • Baumann U.
        • Hayes J.
        • Collins N.C.
        • Shi B.J.
        • Schnurbusch T.
        • Hay A.
        • Mayo G.
        • Pallotta M.
        • Tester M.
        • Langridge P.
        Boron-toxicity tolerance in barley arising from efflux transporter amplification.
        Science. 2007; 318: 1446-1449
        • Tanaka M.
        • Fujiwara T.
        Physiological roles and transport mechanisms of boron: perspectives from plants.
        Pflugers Arch. 2008; 456: 671-677
        • Parker M.D.
        • Ourmozdi E.P.
        • Tanner M.J.
        Human BTR1, a new bicarbonate transporter superfamily member and human AE4 from kidney.
        Biochem. Biophys. Res. Commun. 2001; 282: 1103-1109
        • Jalimarada S.S.
        • Ogando D.G.
        • Vithana E.N.
        • Bonanno J.A.
        Ion Transport Function of SLC4A11 in Corneal Endothelium.
        Invest. Ophthalmol. Vis. Sci. 2013; 54: 4330-4340
        • Kao L.
        • Azimov R.
        • Abuladze N.
        • Newman D.
        • Kurtz I.
        Human SLC4A11-C functions as a DIDS-stimulatable H+(OH-) permeation pathway: partial correction of R109H mutant transport.
        Am J Physiol Cell Physiol. 2015; 308: C176-C188
        • Kao L.
        • Azimov R.
        • Shao X.M.
        • Frausto R.F.
        • Abuladze N.
        • Newman D.
        • Aldave A.J.
        • Kurtz I.
        Multifunctional ion transport properties of human SLC4A11: comparison of the SLC4A11-B and SLC4A11-C variants.
        Am J Physiol Cell Physiol. 2016; 311: C820-C830
        • Kao L.
        • Azimov R.
        • Shao X.M.
        • Abuladze N.
        • Newman D.
        • Zhekova H.
        • Noskov S.
        • Pushkin A.
        • Kurtz I.
        SLC4A11 function: evidence for H+ (OH-) and NH3-H+ transport.
        Am J Physiol Cell Physiol. 2020; 318: C392-C405
        • Loganathan S.K.
        • Schneider H.P.
        • Morgan P.E.
        • Deitmer J.W.
        • Casey J.R.
        Functional assessment of SLC4A11, an integral membrane protein mutated in corneal dystrophies.
        Am J Physiol Cell Physiol. 2016; 311: C735-C748
        • Myers E.J.
        • Marshall A.
        • Jennings M.L.
        • Parker M.D.
        Mouse Slc4a11 expressed in Xenopus oocytes is an ideally selective H+/OH- conductance pathway that is stimulated by rises in intracellular and extracellular pH.
        Am J Physiol Cell Physiol. 2016; 311: C945-C959
        • Ogando D.G.
        • Jalimarada S.S.
        • Zhang W.
        • Vithana E.N.
        • Bonanno J.A.
        SLC4A11 is an EIPA-sensitive Na+ permeable pHi regulator.
        Am J Physiol Cell Physiol. 2013; 305: C716-727
        • Quade B.N.
        • Marshall A.
        • Parker M.D.
        pH dependence of the Slc4a11-mediated H(+) conductance is influenced by intracellular lysine residues and modified by disease-linked mutations.
        Am J Physiol Cell Physiol. 2020; 319: C359-C370
        • Vilas G.L.
        • Loganathan S.K.
        • Liu J.
        • Riau A.K.
        • Young J.D.
        • Mehta J.S.
        • Vithana E.N.
        • Casey J.R.
        Transmembrane water-flux through SLC4A11: a route defective in genetic corneal diseases.
        Hum. Mol. Genet. 2013; 22: 4579-4590
        • Zhang W.
        • Ogando D.G.
        • Bonanno J.A.
        • Obukhov A.G.
        Human SLC4A11 Is a Novel NH3/H+ Co-transporter.
        J. Biol. Chem. 2015; 290: 16894-16905
        • Vithana E.N.
        • Morgan P.
        • Sundaresan P.
        • Ebenezer N.D.
        • Tan D.T.
        • Mohamed M.D.
        • Anand S.
        • Khine K.O.
        • Venkataraman D.
        • Yong V.H.
        • Salto-Tellez M.
        • Venkatraman A.
        • Guo K.
        • Hemadevi B.
        • Srinivasan M.
        • Prajna V.
        • Khine M.
        • Casey J.R.
        • Inglehearn C.F.
        • Aung T.
        Mutations in sodium-borate cotransporter SLC4A11 cause recessive congenital hereditary endothelial dystrophy (CHED2).
        Nat. Genet. 2006; 38: 755-757
        • Kumar A.
        • Bhattacharjee S.
        • Prakash D.R.
        • Sadanand C.S.
        Genetic analysis of two Indian families affected with congenital hereditary endothelial dystrophy: two novel mutations in SLC4A11.
        Mol. Vis. 2007; 13: 39-46
        • Ramprasad V.L.
        • Ebenezer N.D.
        • Aung T.
        • Rajagopal R.
        • Yong V.H.
        • Tuft S.J.
        • Viswanathan D.
        • El-Ashry M.F.
        • Liskova P.
        • Tan D.T.
        • Bhattacharya S.S.
        • Kumaramanickavel G.
        • Vithana E.N.
        Novel SLC4A11 mutations in patients with recessive congenital hereditary endothelial dystrophy (CHED2). Mutation in brief #958.
        Online. Hum. Mutat. 2007; 28: 522-523
        • Sultana A.
        • Garg P.
        • Ramamurthy B.
        • Vemuganti G.K.
        • Kannabiran C.
        Mutational spectrum of the SLC4A11 gene in autosomal recessive congenital hereditary endothelial dystrophy.
        Mol. Vis. 2007; 13: 1327-1332
        • Desir J.
        • Abramowicz M.
        Congenital hereditary endothelial dystrophy with progressive sensorineural deafness (Harboyan syndrome).
        Orphanet J Rare Dis. 2008; 3: 28
        • Vithana E.N.
        • Morgan P.E.
        • Ramprasad V.
        • Tan D.T.
        • Yong V.H.
        • Venkataraman D.
        • Venkatraman A.
        • Yam G.H.
        • Nagasamy S.
        • Law R.W.
        • Rajagopal R.
        • Pang C.P.
        • Kumaramanickevel G.
        • Casey J.R.
        • Aung T.
        SLC4A11 mutations in Fuchs endothelial corneal dystrophy.
        Hum. Mol. Genet. 2008; 17: 656-666
        • Riazuddin S.A.
        • Vithana E.N.
        • Seet L.F.
        • Liu Y.
        • Al-Saif A.
        • Koh L.W.
        • Heng Y.M.
        • Aung T.
        • Meadows D.N.
        • Eghrari A.O.
        • Gottsch J.D.
        • Katsanis N.
        Missense mutations in the sodium borate cotransporter SLC4A11 cause late-onset Fuchs corneal dystrophy.
        Hum. Mutat. 2010; 31: 1261-1268
        • Vilas G.L.
        • Loganathan S.K.
        • Quon A.
        • Sundaresan P.
        • Vithana E.N.
        • Casey J.
        Oligomerization of SLC4A11 protein and the severity of FECD and CHED2 corneal dystrophies caused by SLC4A11 mutations.
        Hum. Mutat. 2011;
        • Lopez I.A.
        • Rosenblatt M.I.
        • Kim C.
        • Galbraith G.C.
        • Jones S.M.
        • Kao L.
        • Newman D.
        • Liu W.
        • Yeh S.
        • Pushkin A.
        • Abuladze N.
        • Kurtz I.
        Slc4a11 gene disruption in mice: cellular targets of sensorineuronal abnormalities.
        J. Biol. Chem. 2009; 284: 26882-26896
      4. Marshall, W., and Grosell M. (2006) Ion transport, osmoregulation, and acid-base balance. in The Physiology of Fishes (Evans, D. H., and Claiborne, JB ed.), CRC, New York. pp 177-230

      5. Hickman Jr, C. P., and Trump, B. F. (1969) 2 The Kidney. in Fish physiology, Elsevier. pp 91-239

        • Kato A.
        • Nagashima A.
        • Hosono K.
        • Romero M.F.
        Membrane Transport Proteins Expressed in the Renal Tubular Epithelial Cells of Seawater and Freshwater Teleost Fishes.
        Front Physiol. 2022; 13939114
        • Beyenbach K.W.
        Kidneys sans glomeruli.
        Am. J. Physiol. Renal Physiol. 2004; 286: F811-827
        • Beyenbach K.W.
        • Petzel D.H.
        • Cliff W.H.
        Renal proximal tubule of flounder. I. Physiological properties.
        Am. J. Physiol. 1986; 250: R608-615
        • Kato A.
        • Doi H.
        • Nakada T.
        • Sakai H.
        • Hirose S.
        Takifugu obscurus is a euryhaline fugu species very close to Takifugu rubripes and suitable for studying osmoregulation.
        BMC Physiol. 2005; 5: 18
        • Aparicio S.
        • Chapman J.
        • Stupka E.
        • Putnam N.
        • Chia J.M.
        • Dehal P.
        • Christoffels A.
        • Rash S.
        • Hoon S.
        • Smit A.
        • Gelpke M.D.
        • Roach J.
        • Oh T.
        • Ho I.Y.
        • Wong M.
        • Detter C.
        • Verhoef F.
        • Predki P.
        • Tay A.
        • Lucas S.
        • Richardson P.
        • Smith S.F.
        • Clark M.S.
        • Edwards Y.J.
        • Doggett N.
        • Zharkikh A.
        • Tavtigian S.V.
        • Pruss D.
        • Barnstead M.
        • Evans C.
        • Baden H.
        • Powell J.
        • Glusman G.
        • Rowen L.
        • Hood L.
        • Tan Y.H.
        • Elgar G.
        • Hawkins T.
        • Venkatesh B.
        • Rokhsar D.
        • Brenner S.
        Whole-genome shotgun assembly and analysis of the genome of Fugu rubripes.
        Science. 2002; 297: 1301-1310
        • Islam Z.
        • Hayashi N.
        • Inoue H.
        • Umezawa T.
        • Kimura Y.
        • Doi H.
        • Romero M.F.
        • Hirose S.
        • Kato A.
        Identification and lateral membrane localization of cyclin M3, likely to be involved in renal Mg2+ handling in seawater fish.
        Am J Physiol Regul Integr Comp Physiol. 2014; 307: R525-537
        • Kato A.
        • Chang M.H.
        • Kurita Y.
        • Nakada T.
        • Ogoshi M.
        • Nakazato T.
        • Doi H.
        • Hirose S.
        • Romero M.F.
        Identification of renal transporters involved in sulfate excretion in marine teleost fish.
        Am J Physiol Regul Integr Comp Physiol. 2009; 297: R1647-R1659
        • Kurita Y.
        • Nakada T.
        • Kato A.
        • Doi H.
        • Mistry A.C.
        • Chang M.H.
        • Romero M.F.
        • Hirose S.
        Identification of intestinal bicarbonate transporters involved in formation of carbonate precipitates to stimulate water absorption in marine teleost fish.
        Am J Physiol Regul Integr Comp Physiol. 2008; 294: R1402-1412
        • Kato A.
        • Muro T.
        • Kimura Y.
        • Li S.
        • Islam Z.
        • Ogoshi M.
        • Doi H.
        • Hirose S.
        Differential expression of Na+-Cl- cotransporter and Na+-K+-Cl- cotransporter 2 in the distal nephrons of euryhaline and seawater pufferfishes.
        Am J Physiol Regul Integr Comp Physiol. 2011; 300: R284-297
        • Oshita K.
        • Seo K.
        • Sabarudin A.
        • Oshima M.
        • Takayanagi T.
        • Motomizu S.
        Synthesis of chitosan resin possessing a phenylarsonic acid moiety for collection/concentration of uranium and its determination by ICP-AES.
        Anal Bioanal Chem. 2008; 390: 1927-1932
        • Tural B.
        Separation and Preconcentration of Boron with a Glucamine Modified Novel Magnetic Sorbent.
        Clean-Soil Air Water. 2010; 38: 321-327
        • Boron W.F.
        • De Weer P.
        Intracellular pH transients in squid giant axons caused by CO2, NH3, and metabolic inhibitors.
        J. Gen. Physiol. 1976; 67: 91-112
        • Kikkawa M.
        • Takano K.
        • Shinagawa A.
        Location and behavior of dorsal determinants during first cell cycle in Xenopus eggs.
        Development. 1996; 122: 3687-3696
        • Ushio K.
        • Watanabe E.
        • Kamiya T.
        • Nagashima A.
        • Furuta T.
        • Imaizumi G.
        • Fujiwara T.
        • Romero M.F.
        • Kato A.
        Boric acid transport activity of human aquaporins expressed in Xenopus oocytes.
        Physiol Rep. 2022; 10e15164
        • Maren T.H.
        • Fine A.
        • Swenson E.R.
        • Rothman D.
        Renal acid-base physiology in marine teleost, the long-horned sculpin (Myoxocephalus octodecimspinosus).
        Am. J. Physiol. 1992; 263: F49-55
        • Takano J.
        • Kobayashi M.
        • Noda Y.
        • Fujiwara T.
        Saccharomyces cerevisiae Bor1p is a boron exporter and a key determinant of boron tolerance.
        FEMS Microbiol. Lett. 2007; 267: 230-235
        • Zenki M.
        • Nose K.
        • Toei K.
        Spectrophotometric Determination of Boron with an Azomethine H-Derivative.
        Fresenius Z Anal Chem. 1989; 334: 238-241
        • Islam Z.
        • Kato A.
        • Romero M.F.
        • Hirose S.
        Identification and apical membrane localization of an electrogenic Na+/Ca2+ exchanger NCX2a likely to be involved in renal Ca2+ excretion by seawater fish.
        Am J Physiol Regul Integr Comp Physiol. 2011; 301: R1427-1439
        • Nawata C.M.
        • Hirose S.
        • Nakada T.
        • Wood C.M.
        • Kato A.
        Rh glycoprotein expression is modulated in pufferfish (Takifugu rubripes) during high environmental ammonia exposure.
        J. Exp. Biol. 2010; 213: 3150-3160
        • Liman E.R.
        • Tytgat J.
        • Hess P.
        Subunit stoichiometry of a mammalian K+ channel determined by construction of multimeric cDNAs.
        Neuron. 1992; 9: 861-871
        • Xie Q.
        • Welch R.
        • Mercado A.
        • Romero M.F.
        • Mount D.B.
        Molecular characterization of the murine Slc26a6 anion exchanger: functional comparison with Slc26a1.
        Am. J. Physiol. Renal Physiol. 2002; 283: F826-838
        • Romero M.F.
        • Fong P.
        • Berger U.V.
        • Hediger M.A.
        • Boron W.F.
        Cloning and functional expression of rNBC, an electrogenic Na+-HCO3- cotransporter from rat kidney.
        Am. J. Physiol. 1998; 274: F425-432
        • Dinour D.
        • Chang M.H.
        • Satoh J.
        • Smith B.L.
        • Angle N.
        • Knecht A.
        • Serban I.
        • Holtzman E.J.
        • Romero M.F.
        A novel missense mutation in the sodium bicarbonate cotransporter (NBCe1/SLC4A4) causes proximal tubular acidosis and glaucoma through ion transport defects.
        J. Biol. Chem. 2004; 279: 52238-52246
        • Sciortino C.M.
        • Romero M.F.
        Cation and voltage dependence of rat kidney electrogenic Na+-HCO3- cotransporter, rkNBC, expressed in oocytes.
        Am. J. Physiol. 1999; 277: F611-623
        • Chang M.H.
        • Plata C.
        • Kurita Y.
        • Kato A.
        • Hirose S.
        • Romero M.F.
        Euryhaline pufferfish NBCe1 differs from nonmarine species NBCe1 physiology.
        Am J Physiol Cell Physiol. 2012; 302: C1083-1095